1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
meriva
3 years ago
12

The tissue that prevents food from entering the trachea is the _______.

Biology
1 answer:
Alona [7]3 years ago
3 0
The correct answer for this question is letter C. Epiglottis is the one who prevents food from entering the trachea. It moves in a back and forth manner. When a person swallows, it covers the entrance of the larynx by flattening itself backwards.
You might be interested in
900.j of work are done by a light bulb in 15.0 s. What is the power of the light bulb?
vovangra [49]
well power is equal to work multiplied by time so .. 900j divided by 15 s will give you 60 Watt as your answer
3 0
3 years ago
A recessive allele is usually represented by
kogti [31]

Answer:

Recessive alleles are usually represented by lowercase letters and require two copies to be expressed

Explanation:

5 0
3 years ago
Read 2 more answers
How are food chains and food webs related
oksano4ka [1.4K]

Answer:

A food web consists of many food chains. A food chain only follows just one path as animals find food. eg: A hawk eats a snake, which has eaten a frog, which has eaten a grasshopper, which has eaten grass. A food web shows the many different paths plants and animals are connected.

Explanation:

3 0
3 years ago
The branch of the autonomic nervous system that slows down the body as it recovers from exposure to a stressor is the __________
insens350 [35]
Sympathetic is the answer
4 0
2 years ago
Read 2 more answers
What does it mean by a "genetically engineered seed "?
pantera1 [17]

Genetically engineered seed, or GMO, are foods produced from organisms that have had changes introduced into their DNA using the methods of genetic engineering.

8 0
3 years ago
Other questions:
  • What must a single-celled organism do before it can reproduce​
    7·2 answers
  • The number of organisms in each trophic level are represented in a
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The decimal reduction time (DRT) to kill 90% of cell present for autoclaving a culture is 1.5 minutes. How long would it take to
    8·1 answer
  • I need someone to type up a bit on natural selection and population dynamic. Specifically how genetic variations of trait may in
    8·1 answer
  • PLEASE HELP!!! WILL MARK BRAINLIST!!!!
    11·2 answers
  • You have come across a website with the following
    7·1 answer
  • How does a ligament injury disrupt affect body tissue?
    9·1 answer
  • During a procedure called ___, angela's knee pain and joint stress is relieved when her inflamed joint space is punctured with a
    9·1 answer
  • Location e is located at the tropic of cancer, while location f is at the equator. which location is likely to be warmer at the
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!