1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
meriva
3 years ago
12

The tissue that prevents food from entering the trachea is the _______.

Biology
1 answer:
Alona [7]3 years ago
3 0
The correct answer for this question is letter C. Epiglottis is the one who prevents food from entering the trachea. It moves in a back and forth manner. When a person swallows, it covers the entrance of the larynx by flattening itself backwards.
You might be interested in
Question 9 (5 points)
Rainbow [258]

Answer:

b. cobalt, iron, and nickel

Explanation:

5 0
3 years ago
Read 2 more answers
Which is a difference between bacteria and viruses that shows that bacteria are living organisms and viruses are not?
sammy [17]
Only bacteria can reproduce outside a host and bacteria are not dependent on a host
8 0
3 years ago
Read 2 more answers
The following are uses conversation gambits except​
jeka94
I don’t know to be honest what are the choices
4 0
3 years ago
True/False. Multiple polypeptides joined together represents the tertiary level of protein organization.
bonufazy [111]

It is <u>TRUE</u> that multiple polypeptides joined together represents the tertiary level of protein organization.

6 0
2 years ago
A method used by horticulturalists when they rotate the use of fields—planting crops on a particular piece of land for a period
svetoff [14.1K]

Answer:

The correct answer will be- Crop rotation

Explanation:

When the growth of a type of crop which uses soil nutrients in abundance and then growing another crop in the same filed led to the decrease in the production of the next crop.

Thus farmers adapted to avoid such farming practices and developed a new practice which allowed the land to become fertile again so that the growth of next crop will not be affected.

The practice involved the planting of a crop on a piece of land then leaving the soil ploughed and unsown for a longer period of time and growing corp on another piece of land allowing the time to restore the nutrient content. This practice is known as "crop rotation".

Thus, crop rotation is the correct answer.

8 0
3 years ago
Other questions:
  • HELP PLEASE ASAP!!!! I don't understand this
    14·2 answers
  • What albedo has to do with arctic sea ice melt.​
    8·1 answer
  • If two eukaryotes participate in lateral gene transfer what will this do to the overall genetic variation of the
    12·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Explain how the cell cycle is normally controlled, including reference to the role of tumor-suppressor genes:
    15·1 answer
  • Females who died before 1948
    5·1 answer
  • What substance in oxidized during cellular respiration ?
    13·2 answers
  • Analyze the graph showing the rate of photosynthesis activity as a function of carbon dioxide levels. Select as many of the choi
    12·2 answers
  • If the statement is true, write true. If the statement is false
    10·1 answer
  • Where is the medulla oblongata located.​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!