1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ruslelena [56]
3 years ago
11

What are the disadvantages of polygamous in animals

Biology
1 answer:
yKpoI14uk [10]3 years ago
5 0

Answer:

The principal disadvantage of monogamy is a lack of variety. Monogamy has the potential to lead to routine, and possibly boredom. People often equate excitement in a relationship with the ability to be with a number of individuals, potentially as part of an open or sometimes polyamorous relationship.

Explanation:

You might be interested in
A species of fly has two alleles for the length of their legs. The allele for long
Artyom0805 [142]
The answer is A. 0.54.

In a population p+q=1 (we have 2 alleles only).

The question states that 0.21 of the population(21%) have short legs meaning they are q^2.

So q=rad0.21=0.4582.

And p=1-q=0.5417.
3 0
3 years ago
Read 2 more answers
What is the goal of technology?
Lapatulllka [165]

Answer:

The correct answers is D

7 0
3 years ago
If a horse and zebra breed to produce a sterile horse.____
Vaselesa [24]

Answer:

Biogeographic isolation is the separation of organisms of a species through geographical or biological forces.

Explanation:

4 0
3 years ago
A solution is classified as a weak base. Which of these could be the pH of the solution?
timama [110]

Answer:

C

Explanation:

pOH increases from 7 towards 14.

7 0
3 years ago
What are the events unique to Mitosis?​
Harman [31]
Three events unique to meiosis are that synapsis and crossing over happen in prophase one, at the metaphase plate the chromosomes are paired in teatrads, also in anaphase one homologous chromosomes are separated and sent to opposite poles of the cell.
5 0
3 years ago
Other questions:
  • Should killer whales be kept in marine parks be free in the wild wikipedia
    5·1 answer
  • Which example of artificial selection is caused indirectly by human activity?
    8·1 answer
  • What are some of the short-term risks associated with smoking? (Site 2)
    13·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Bile
    7·1 answer
  • A student drew the following flowchart to show the movement of nutrients.
    6·2 answers
  • An amplified recording of the waves of electrical activity that sweep across the surface of the brain is called a(n):_______
    13·2 answers
  • PLEASE HELP!! WILL MARK BRAINLIEST!!
    13·1 answer
  • 1
    14·2 answers
  • Because the skin sloughs off on a regular basis, the most superficial layer of the epidermis is primarily composed of what type
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!