1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sophie [7]
3 years ago
15

A teacher says she has identified an organism with these characteristics: eukaryotic, multicellular, autotrophic, and a cell wal

l made of cellulose. Which kingdom is the teacher describing?
Biology
1 answer:
Alex73 [517]3 years ago
6 0
Plantae cell (option C)
You might be interested in
Height and eye colors are two examples of continuous variation in humans, whereas in pea plants the tall allele is dominant over
ycow [4]
<span>This shows that, in most species, a characteristic is controlled by a suite of genes instead of having only one gene doing all the work. Polygenic traits are much more common than monogenic, which leads to an entire range of outcomes being possible, instead of having an either-or outcome.</span>
5 0
3 years ago
Embryonic tissues develop during the _________ stage.
Hitman42 [59]
<span>Embryonic tissues or germ layers develop during the gastrulation stage.</span> <span>Gastrulation is a process in embryonic development during which the single-layered blastula is reorganized into a three-layered(or two-layered) structure called the gastrula. <span>Two primary germ layers(embryonic tissues) are an inner layer-endoderm and an outer layer-ectoderm. Endoderm and ectoderm interact and produce a third layer-mesoderm. Gastrulation is followed by organogenesis, three germ layers will give rise to specific tissue and organ.For example, ectoderm gives rise to epidermis and nervous system, endoderm to the digestive system and mesoderm to muscles, bones…</span></span>
6 0
3 years ago
To test the hypothesis that a particular plant synthesizes storage lipids by using glyceraldehyde 3-phosphate (G3P) from photosy
Nookie1986 [14]

Answer:

Radiolabeled carbon atom in CO2

Explanation:

Photosynthesis is the process by which green plants fix the atmospheric CO2 into glucose. The process includes carbon fixation during which RuBisCo enzyme catalyzes the reaction of CO2 and a five-carbon compound called RuBP to form 3-phosphoglycerate (3-PGA). The 3-PGA enters the reduction phase of the Calvin cycle wherein it is reduced into glyceraldehyde 3-phosphate. Two molecules of glyceraldehyde 3-phosphate make one molecule of glucose.

To test the hypothesis that glyceraldehyde 3-phosphate from photosynthesis is used by plants to synthesize lipids, radiolabeled CO2 must be used. The radiolabeled carbon atom in the CO2 would be fixed in the form of glyceraldehyde 3-phosphate. If the plant uses glyceraldehyde 3-phosphate as a precursor for lipid synthesis, the synthesized lipid molecules would carry the radiolabeled carbon atom.

8 0
3 years ago
When fructose and glucose are bonded together, they form?
faust18 [17]
Table sugar I'm pretty sure
7 0
3 years ago
A landslide quickly roads sediment on a steep hill. When the landslide reaches the bottom of the hill, it slows down and finally
yarga [219]

Answer:

Deposition

Explanation:

Landslides occur under the effect of gravity. When a mass of rock or earth slides down from a mountain or from a cliff then this phenomenon is termed as Landslide.

Landslides are considered to be a rapid method of erosion.  Wind, waves, running water, glaciers and gravity are the five agents of erosion out of which the gravity influences the process of Landslides.

Landslides occur suddenly and are dangerous example of the movement of earth materials under the influence of gravity. When weathered material falls away from a cliff, it slides down under the effect of gravity and finally after reaching the hill, the material gets deposited there. This is called Deposition by landslides.

7 0
3 years ago
Other questions:
  • The choice of which material in the portrait group of tetrarchs speaks to imperial power?
    11·1 answer
  • How can cyanobacteria in contrast to saprotrophic bacteria, live in an enviroment that lacks organic material?
    10·1 answer
  • PLS HELP Magnesium + hydrochloric acid → magnesium chloride + hydrogen Mg + 2HCl → MgCl2 + H2 In this reaction: Magnesium (Mg) i
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A litter of four kittens includes one with black hair and blue eyes, one with black hair and orange eyes, one with brown tabby h
    15·1 answer
  • The biconcave shape of erythrocytes is a result of__________. peripheral proteins anchored to the inner surface of their plasma
    12·2 answers
  • A mutation occurred that caused a change in a mRNA sequence the mRNA codon UAC was replaced by codon UAA which statement describ
    11·1 answer
  • Someone help with this pls
    9·1 answer
  • In order to fit all of our DNA into our cells, it is wrapped around histone proteins and then __________.
    11·1 answer
  • . Folkman used what organ from a rabbit in his artificial blood experiments? *
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!