1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ierofanga [76]
3 years ago
5

Which process produces only identical offspring

Biology
1 answer:
nignag [31]3 years ago
6 0
Asexual reproduction is a process wherein cells produce genetically identical offspring.

Since asexual reproduction is when offspring are produced from a single parent, the offspring are identical to the parent. Sometimes, asexual reproduction is called cloning. Cloning is the production of two identical genetic copies from a single parent cell.


You might be interested in
How are community population and ecosystem similar?
sp2606 [1]

in a community there are people right? well in an ecosystem there are animals and organism.

4 0
3 years ago
How does low population density tend to affect population growth?
ser-zykov [4K]

Answer: Low population density Tend to decrease birth rates and increase mortality rates.

Explanation:

4 0
3 years ago
A while mates with a blavk hen. The offspring is gray color. What is this phenomenon called
Lynna [10]

Answer:

Incomplete Dominance

Explanation:

Incomplete dominance is a phenomenon in which the alleles of two genes are not completely dominant over each other and so when they are present at the same time in an organism (heterozygous for that gene) the organism will have an intermediate phenotype that is a combination of both phenotypes.

For example: The flower color in Snapdragon can have three different genotypes as well as phenotypes. The flowers can be red, pink or white depending on their genotype. The allele for red flower (R) is incompletely dominant over allele of white flower (r). A plant with genotype RR will be red flowered and that with rr will be white flowered. However, if a plant has genotype Rr (intermediate), then the flowers will be white in which no allele was dominant over the other and both showed their effect giving a combination of two colors as Pink flowers.

Same is the case with the mating between white and black hen, where offspring was grey in color. This grey was a combination phenotype of two phenotypes.

Hope it helps!

7 0
3 years ago
If your job were to inform the smiths of their test results, what would you say?
babunello [35]
Good job you got a ___ on your test!
4 0
3 years ago
Why do the cells of multicellular organism often look different?
Zolol [24]
<span>All cells in our bodies contain the same exact DNA, believe it or not. It's all epigenetic. The different shapes and functions are due to cellular differentiation and gene expression/silencing.

</span>
8 0
3 years ago
Other questions:
  • Every time an impulse travels down the axon, we say that the axon has "fired," or "responded." this impulse is also called the
    10·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Which of the following
    7·2 answers
  • Which condition can cause a population crash?
    11·1 answer
  • List three (3) types of morphological characteristics of microorganisms which may be determined without using a microscope.
    11·1 answer
  • According to the chart, which substance has the lowest OH- concentration?
    15·2 answers
  • I NEED HELP WITH THIS QUESTION ABOVE!!
    11·1 answer
  • Why would it be correct to say that heat rises? Explain....
    5·1 answer
  • A drought decreases the water level in Lake Winnipeg. The carrying capacity of the lake decreases.
    9·1 answer
  • How does energy flow between the sun plants and other organisms?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!