1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
10

(Ch. 27.4) Many people are allergic to substances in the environment, such as ragweed pollen, as well as foods, such as peanuts.

Which of these statements BEST describes an allergic reaction to one of these substances? (1 point) A. The substance is similar or identical to human antigens, and so it triggers an immune system response. B. The substance invades the body and causes damage to tissues, which triggers an immune system response. C. The substance does not directly harm tissues and is not a pathogen, but nevertheless triggers an inflammatory response. D. The substance invades the body and triggers a response from the respiratory system or digestive system, but not the immune system.
Biology
1 answer:
djverab [1.8K]3 years ago
3 0

Answer:

C. The substance does not directly harm tissues and is not a pathogen, but nevertheless triggers an inflammatory response.

Explanation:

When a person is allergic to a substance, his or her immune system recognizes a harmless substance, such as components in food, pollen, or dust, as a treat. As a consequence, it starts an immune response that leads to inflammation. The substance that starts the allergic reaction is called an allergen, and it is not a pathogen because it is not a real threat to the body since it does not infect cells. When the allergen enters the body, it binds to antibodies that are in contact with a special type of cell. These specific cells will release a substance known as histamine. Histamine will produce an inflammatory reaction affecting different tissues in our body. For example, it can make us sneeze, have a running nose, swelling parts of our body, have itchiness and redness, amongst others.

You might be interested in
What is the geologic column?
Svetllana [295]
The answer should be A
5 0
3 years ago
Read 2 more answers
Why is photosynthesis described as a chemical rection
vovangra [49]

Answer:

Even though it can be undone, a new product is formed in photosynthesis. So it's a chemical process

4 0
3 years ago
What are the diference between aerobic and anaerobic cellular respiration?
stich3 [128]
Aerobic respiration uses oxygen to produce ATP. Anaerobic respiration uses inorganic molecules to produce ATP. I hope that answered your question, my friend. :)
5 0
4 years ago
Read 2 more answers
imagine that you could treat chloroplats with an indiicator dye that turns red in acidic conditions, yellow in neutral ocndition
zmey [24]

The amount of light between points 1 and 2 is adequate for photosynthesis to occur at a faster rate than cellular respiration. Acidic conditions typically imply that the solution has an excessive concentration of H+, which makes the solution acidic. By dividing the reaction into half-reactions, the balancing process begins.

This indicates that more CO2 is being consumed than is being produced, which makes the problem more straightforward.

The signal will become purple as a result, from yellow. After point 2, light levels are low enough that cellular respiration outpaces photosynthesis, which results in more CO2 being generated than being absorbed and raising the pH of the solution. The indication will become yellow as a result, from purple.

An indicator dye called bromothymol blue (BMB) changes color from blue to yellow when acid is present. The pH of the solution decreases when carbon dioxide is introduced because it produces carbonic acid. When the pH is greater than 7.6, green, between 6.7 and 7.6, and yellow, less than 6, BMB is blue.

Learn more about to acidic conditions visit here;

brainly.com/question/14697894?

#SPJ4

3 0
1 year ago
How did they produce news paper la stampa in italiano
grigory [225]
They printed or wrote words on paper. I don't know.
5 0
3 years ago
Other questions:
  • Which relationship best demonstrates cooperation between species?
    15·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Calculate the mass defect for oxygen-16 given this data. Round to the 5es001-1.jpg decimal place. mass of an oxygen-16 atom: 15.
    11·2 answers
  • After the bases of DNA were identified, Erwin Chargaff analyzed the percentages of adenine, thymine, guanine, and cytosine in th
    14·1 answer
  • Where the egg of fishes are kept for developing into fry
    14·1 answer
  • A structure outside the plasma membrane in some cells is the _____
    12·1 answer
  • What is the first step of the scientific method?
    8·2 answers
  • How do Hadley cells affect savannas climate
    6·1 answer
  • What type of molecule "unzips" DNA to facilitate the process of replication? *
    15·1 answer
  • How does an inhaler work?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!