1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elodia [21]
3 years ago
12

A hiker crosses topography near the sea that has low elevation and low relief and then climbs up steeply to reach a peak.

Biology
1 answer:
Anuta_ua [19.1K]3 years ago
6 0

Answer: mountain and coastal plains

Explanation: i just took the exam

You might be interested in
Define: Enzyme (in your own words) <br> plz help
Luda [366]
An enzyme is a protein molecule in cells which works as a biological catalyst. *brainliest pls*
4 0
2 years ago
Name the enzyme that catalyzes the reaction that converts fibrinogen to fibrin.
IceJOKER [234]
<span>The enzyme name that catalyzes the reaction that converts fibrinogen to fibrin is <span>Thrombin. </span>The thrombin is an enzyme - type peptidases. It is not part of the blood, but is <span>formed as part of the blood clotting process.</span></span>
3 0
3 years ago
Why are some of us more prone than others to coronary heart disease?
cricket20 [7]
"Coronary heart disease, North America’s number one cause of death, has been linked with the competitive, hard-driving, impatient, and (especially) anger-prone Type A personality. Under stress, the body of a reactive, hostile person secretes more of the hormones that accelerate the buildup of plaque on the heart’s artery walls. Type B personalities are more relaxed and easygoing. Chronic stress also contributes to persistent inflammation, which heightens the risk of clogged arteries and depression."

OR

Coronary heart disease (CHD) could be the thinning or impediment in the coronary thrombosis veins, normally brought on by coronary artery disease. Coronary artery disease (at times termed “stiffing” or maybe “blocking” in the arterial blood vessels) may be the build-up associated with trans fat and fatty deposits (named plaques) around the intrinsic artery walls.



7 0
3 years ago
A log is added to a camp fire and is burned. This is an example of a _ change. Physical change or chemical ? Plz help thx
a_sh-v [17]

Answer:

chemical change

Explanation:

6 0
2 years ago
Read 2 more answers
Cells need energy in order to carry out their life processes. In heterotrophs, this energy is acquired when
shutvik [7]
Nutrient molecules are broken down
5 0
3 years ago
Read 2 more answers
Other questions:
  • One cause of fatigue and anemia in adolescent girls with low dairy product intake is deficiency of _________.
    10·1 answer
  • Is this a testable question ?
    10·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Had you been Louis Pasteur what would have been your reflections and conclusions based on this experiment?
    8·1 answer
  • __________ are water-soluble, complex glycoproteins that are secreted by goblet cells.__________ are water-soluble, complex glyc
    5·1 answer
  • Sunlight can be considered a food resource
    15·2 answers
  • A paper mill located on a coastal region of Florida experienced an
    5·1 answer
  • Help me figure this out!!!
    5·2 answers
  • Identify the reactant(s) in the chemical reaction, CO2 + H2O → H2CO3.
    11·1 answer
  • Two parents who have type AA And Ai blood will have children with which blood<br> type?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!