1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elodia [21]
3 years ago
12

A hiker crosses topography near the sea that has low elevation and low relief and then climbs up steeply to reach a peak.

Biology
1 answer:
Anuta_ua [19.1K]3 years ago
6 0

Answer: mountain and coastal plains

Explanation: i just took the exam

You might be interested in
Which of these is the claims
andrew11 [14]
I’m not sure but I think it’s A or C
4 0
2 years ago
MATCH THE FOLLOWING
Kaylis [27]

Answer:

1) Homologous chromosomes are chromosomes that are the same in size and shape and control the same characteristics; occur in pairs in higher animals and plants

2) Internal fertilization is a mating pattern in which the male and female come close together, the male introduces the sperm into the body of the female, and fertilization occurs. It is practiced by mammals like goat, sheep etc

3) Pollination is the transfer of pollen from male to female cones in gymnosperms, or from anther to stigma in flowering plants. It is effected by insects, birds, bats and the wind.

4) Zygote is the result of fertilization in which two gametes have fused together; often simply called a fertilized egg.

7 0
3 years ago
Why does red pepper flakes make mold grow faster on foods?
lidiya [134]

Answer:

Because it is proccessed

Explanation:

And has preservatives

5 0
2 years ago
Read 2 more answers
What is the name for all physical material in the universe?
Kobotan [32]

Answer:

Matter

Explanation:

6 0
3 years ago
Should the amendment , which allows for free speech , include all types of speech ? What about bad language racial slurs , and o
Afina-wow [57]

Explanation:

No because a speech has to be a meaningful speech

3 0
2 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • The term meaning inflammation of the spinal cord is __________. this term also means inflammation of bone marrow.
    9·1 answer
  • An artery carries _____ blood _____ the heart.
    7·2 answers
  • Which of the following factors can influence advances in science and technology?
    10·1 answer
  • Need help with these questions! Will give brainliest answer/thanks/5 star
    6·1 answer
  • Why do animals exist in various species
    14·1 answer
  • 1. Which of the following is NOT a reason to consider when selecting the location of
    14·2 answers
  • EMERGENCY HELP FAST!!<br><br> Fats and oils are esters. They contain a ____ group.
    5·1 answer
  • DNA ___________ is important because it ensures that when a cell divides, the two resulting cells have the same genetic code. Pl
    8·1 answer
  • The cell theory is a shared understanding that expresses our current
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!