1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rom4ik [11]
3 years ago
10

A monocular cue for depth that cannot be used by artists in their paintings is _____.

Biology
1 answer:
Alex777 [14]3 years ago
7 0
The answer is Accommodation
You might be interested in
Perforation plates are characteristic of the ________ of __________.
nydimaria [60]
Characteristic of the Vessel elements of Angiosperms
3 0
3 years ago
Unlike mitosis, meiosis results in the formation of
ankoles [38]
It results in four genetically different cells
3 0
3 years ago
Read 2 more answers
Willful muscle contraction; emotions
777dan777 [17]
Its the frontal lobe. :)
8 0
3 years ago
PLEASE, SOMEONE HELP ME! :) When we think about the effects of air pollutants we immediately think of respiratory issues. Exposu
SVETLANKA909090 [29]
Working down mate, my best answer would be carbon monoxide, but I'm not studying exactly what you are.  All those answers are logical except ozone.
8 0
3 years ago
Why were there no living inhabitants on earth for the first billion years?
Nutka1998 [239]

There was no life on Earth for the first billion years because the atmosphere was not suitable for life. Earth's first atmosphere had lots of water vapor but had almost no oxygen. Later, frequent volcanic eruptions put several different gases into the air.

4 0
2 years ago
Other questions:
  • Dna replication makes a(n) ________ copy of the dna strand, while transcription makes a(n) ________ copy of the dna strand.
    6·1 answer
  • Four different thermometers were used to measure the temperature of a sample of pure boiling water. The measurements are recorde
    14·1 answer
  • To avoid such dangerous results, it is important to give a patient compatible blood. Which type of blood can a person with Type
    15·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which kind of cell is also called an epithelial
    13·2 answers
  • Which of the following elements makes up the smallest percentage of the atmosphere?
    14·2 answers
  • Which statements describe the process of scientific inquiry
    5·2 answers
  • Which of the following are located in the dermis of the skin?
    7·1 answer
  • An _______________ is a group of organisms and other non-living parts of the environment that lives in an area.
    8·1 answer
  • It takes energy for an organism to produce a particular structure such as a stripe on a clover leaf that is otherwise plain.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!