1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oee [108]
3 years ago
15

During which three phases are individual chromosomes no longer visible

Biology
2 answers:
Taya2010 [7]3 years ago
7 0

Answer: "Telophase" Chromosomes disperse and are no longer visible.

Explanation:

avanturin [10]3 years ago
5 0
I believe it is interphase
You might be interested in
A dehydration synthesis reaction is best described as a chemical reaction in which
Radda [10]

two molecules or moieties combine to form one single molecule, together with the loss of a small molecule. When this small molecule is water, it is known as a dehydration reaction; other possible small molecules lost are hydrogen chloride, methanol, or acetic acid.

8 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
A scientist is examining a single celled organism that is often found in the human body some examples of this organism are helpf
lbvjy [14]

Answer:The answer Is Eubacteria

Explanation: I took the test ahaha :) Hope This helps.

4 0
3 years ago
ASAP / IMAGE LINKED:
stira [4]

Answer:

genetic diversity

red yellow and orange bell peppers

individuals of the same lizard species      

species diversity

a park has eighty species of trees

five bird species are at a bird feeder

Explanation:                                                              

8 0
3 years ago
What's the answer pleaseee??!!!
Troyanec [42]

Answer:

the first one

Explanation:

So the predicted offspring genotypes are 50% Hh and 50% hh

so there is a 50% chance that they will have no horns and and aa 50% chance that they wont

3 0
2 years ago
Other questions:
  • Which of these could you find in the benthic zone of a lake?
    5·1 answer
  • Which statement is true about the total number of chromosomes in most eukaryotic cells? A. Chromosome numbers vary widely. B. Pl
    5·1 answer
  • Which of the following is not associated with translation
    10·2 answers
  • Which of the following is true of DNA only?
    9·1 answer
  • How are the organ system in a human interrelated
    7·1 answer
  • What processes are necessary in order to turn sand into rock?
    10·1 answer
  • Technician A says that spark knock, ping, and detonation are different names for abnormal combustion. Technician B says that any
    8·1 answer
  • Which features are unique to insects as compared to birds?
    13·1 answer
  • What happens during prophase?
    7·2 answers
  • Some people see hydroelectric energy, energy harnessed from water movement, as a clean alternative to fossil fuels. Others belie
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!