1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
boyakko [2]
2 years ago
15

2. Name three plants that reproduce by vegetative propagation.

Biology
1 answer:
baherus [9]2 years ago
5 0
Hens, chickens, and coleus
You might be interested in
A man who heavily smokes has developed lung cancer. The tobacco smoke has caused mutations in some of the cells in his lungs, ma
neonofarm [45]

If he inherited a mutation that made him more susceptible to lung cancer, it may have been present in some of the gametes he produced and passed to his children is the circumstance that might his concern for his children be justified.

<h3>What do you mean by Mutation?</h3>

A Mutation may be defined as sudden, stable, and inheritable changes in the genetic material of an organism.

Gametes of germline cells play an important role in the inheritance of mutation from parents to their offspring, which means that if a mutation has occurred in an egg or sperm cell, it will be more chances that the offspring carry mutated DNA.

Therefore, it is well-described above.

To learn more about Mutations, refer to the link:

brainly.com/question/17031191

#SPJ1

6 0
2 years ago
What is the primary way that metamorphic rocks form?
allochka39001 [22]
<span>Metamorphic rocks form by existing rocks join together under high heat and pressure. Examples of metamorphic rocks are marble, schist, slate, and quartzite. Metamorphic rocks formed when the minerals are chemically changed due to heat and pressure. They are often seen near magma but they do not melt like igneous rock.</span>
6 0
3 years ago
Read 2 more answers
For each sequence of DNA is shown. Write the complementary RNA sequence underneath the letters, then use the codon chart to dete
olga nikolaevna [1]
RNA: AUGGUACCUUAAUGA

A=U (in RNA only. T in DNA)
C=G (in both DNA and RNA)
7 0
2 years ago
HELP!!!!!!!
Lady_Fox [76]
A? I not sure or c maybe
4 0
3 years ago
Read 2 more answers
List three ways by which phosphates are transferred from the land to water. In your own words, explain how these might impact th
masya89 [10]
Phosphates generally come from fertilizer,  erosion of phosphate-containing rocks.   they are fertilizers, so they tend to strongly encourage growth, particularly of bacteria and algae. This can  harm ecologies, particularly in water, and particularly where there isn't a very robust growth medium already, e.g. in cold or desert waters.<span>This impacts the environment and our health because we use tap water for cooking, bathing, brushing teeth, and etc. and these water by be contaminated because of all of this pollution going around</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • Products and reactants in a balanced chemical reaction have the same number of _______ of each element.
    10·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Blank occur when the partially positive blank attract partially negative atoms nearby examples include the blank
    9·1 answer
  • Euglena use __________ to move through their environment and to help collect food.
    15·1 answer
  • There are some similarities between prokaryotic and eukaryotic cells. Which structures is found in both prokaryotic and eukaryot
    12·1 answer
  • What is the genotype of a women who is a carrier heterozygous for color blindness
    15·1 answer
  • One condition in the body that needs to be controlled is the level of
    10·1 answer
  • ATP synthase in the inner mitochondrial and chloroplast membranes is a A)nucleic acid B)triglyceride C)phospholipid D)protein E)
    10·1 answer
  • fredrick griffith made a scientific discovery in 1928, which best describes the knowledge about genetics before 1928?
    13·1 answer
  • According to the dietary guidelines, adults should _______________ intake of fat-free or low-fat milk and milk products.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!