Answer:
yes its not alive all living things are made up of cells, if sth does not have cells its not alive
~batmans wife dun dun dun.....
For the answer to the question above,
Water absorbs vast amounts of energy. Likewise bodies of water release energy very slowly. Areas near water are usually milder. Organic materials (such as plants and animals) tend to absorb more energy. Unlike a desert that holds it. Thus air temp. in a forest is usually cooler than the temp. in a desert.
Since land and water heat at different temperatures, the effects of this process creates climates. For instance, warm weather and moisture from oceans can create hurricanes. I hope this helps
Answer:
The phenotype of the rabbit is the absence of fur colour and the genotype is the alleles rr.
Explanation:
The genotype can be described as the genes which are present in an organism. Genes are made up of alleles. As the rabbit in the question carries the alleles, rr, hence it is the genotype of the white albino rabbit.
The phenotype can be described as the physical appearance that results from the particular genes present in an organism. As the white albino rabbit carries the alleles,rr, due to which it doesn't have fur, hence no fur is the phenotype of it.
Millimeters are the answer here friend. hope you have a bugunga day!
(pronounced bu-gun-ga)
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
