1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
3 years ago
9

Based on figure 9-4, which pathway is most efficient at producing energy for a cell? Explain your answer.

Biology
2 answers:
Reika [66]3 years ago
4 0
I would say Pathway A. It required the fewest steps and input.
Maksim231197 [3]3 years ago
3 0

Answer:

The correct answer would be pathway C.

Pathway C represents aerobic respiration whereas pathways A and B represent fermentation.

Under aerobic respiration, the cell or organism is able to completely oxidize the glucose.

It produces a large amount of energy (approximately 36-38 ATP) as compared to the fermentation which only produces two molecules of ATP.

Most of the reactions of aerobic respiration take place in the mitochondria.  

It includes glycolysis, pyruvate decarboxylation, Krebs cycle, electron transport chain, oxidative phosphorylation.

You might be interested in
Which essential life functions do viruses share with other living organisms
weqwewe [10]

Answer:

it needs a host to steal its nutrions to survive kind of like a leach

Explanation:

6 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
The Super-Volcano erupts in Yellowstone National Park. Lava, ash, etc. devastates 2/3 of the USA leaving newly cooled rock
diamong [38]
B) Primary is where there is nothing no rock or soil
3 0
3 years ago
Which can disrupt the cell cycle?<br> A.mutation<br> B.G0 phase<br> C.replication<br> D.cancer
Aneli [31]

Answer:

c

Explanation:

c

5 0
3 years ago
Read 2 more answers
Which of the following is NOT true? Question 10 options: DNA is found in the nucleus. DNA replication produces four new strands
babunello [35]
DNA and RNA each contain four nitrogenous bases. They have 5 not 4.
6 0
3 years ago
Other questions:
  • Can someone in biology help me please !!!!!
    12·1 answer
  • The most common molecule in the body is made up of what elements?
    14·1 answer
  • James observes an orbiting body that is approximately 5.2 AU away from the Sun. He knows that it is primarily composed of helium
    13·2 answers
  • The pre-colonial diet of natives of the Pacific Islands included eating
    11·1 answer
  • Trees produce energy from sunlight. Animals eat tree leaves for energy. This is an example of ____________ . *
    10·1 answer
  • Typical minerals in Felsic igneous rocks are?
    15·2 answers
  • Do the information given and the map best describe adaptive evolution, convergent evolution, or coevolution? Explain
    6·2 answers
  • Plss help Due today! 40 points and brainliest to best answer!! Help Plzzz!
    12·1 answer
  • Why are X-linked traits more common than Y-linked traits?
    8·1 answer
  • How do DNA and mRNA vaccines produce spike proteins ? Drag each item into the correct category.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!