1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ankoles [38]
3 years ago
9

Explain Earth’s gravity as it orbits the Sun.

Biology
1 answer:
cupoosta [38]3 years ago
8 0

Answer:

the Earth orbits the Sun because of the pull of the Sun's gravity. This happens because the Earth has a acceleration in the direction perpendicular to the force of the Sun's pull and if the Sun weren't there, the Earth would travel in a straight line.

Explanation:

You might be interested in
Can DNA be extracted from dead cells
Strike441 [17]
The short answer is yes. Based on your DNA, your body is better suited for some foods than others. This company found that 45% of people’s genes need a high carb diet, 47% need moderate and only 8% need low.

Hope this helped! <3
7 0
3 years ago
Wich is larger a basketball or a brick
gregori [183]

Answer:

basketball

Explanation:

it takes up more matter

3 0
3 years ago
Read 2 more answers
15
lozanna [386]

The role of oxygen in cellular respiration is It accepts electrons and keeps the electron transport chain running.

<h3>What is Cellular respiration?</h3>

Energy is the ability to perform a job or to produce heat. Chemical reactions involve a rearrangement of atoms between substances with rupture or formation of chemical bonds and this generates changes in the energy of the system.

An exothermic reaction is one where energy is released from the system into the environment in the form of heat.  

Cellular respiration is carried out in the mitochondria of the cells. There the oxygen absorbed from the external environment is combined with carbohydrates (raw material) to release the chemical energy they contain. Water vapour and carbon dioxide are also released.

Thus, option "A" is correct.

To learn more about cellular respiration click here:

brainly.com/question/13721588

#SPJ1

5 0
2 years ago
The portion of the brain associated with motor control is the ________
Zepler [3.9K]
Cerebrum is associated with motor responses.
3 0
4 years ago
Which is a behavioral adaptation of a bear?
Paladinen [302]

Answer:

Hibernating in winter

Explanation:

A behavioral adaptation is something an animal does usually in response to some type of external stimulus in order to survive.

8 0
2 years ago
Read 2 more answers
Other questions:
  • Indica el nombre y la fucion de los vasos sanguineos que entran y salen de los riñones
    12·1 answer
  • Some snakes have special sensory organs that detect the infrared region of the electromagnetic spectrum. Compared with human vis
    10·2 answers
  • Osmosis can be defined as
    15·2 answers
  • What effect does the greenhouse effect have on the earths water cycle
    14·1 answer
  • At rest, the membrane of the cell is slightly permeable to ___________________, the positively charged ion that is most responsi
    15·1 answer
  • When new individuals enter a population, genetic diversity ____________.
    11·1 answer
  • Which body part is included in the circulatory system
    12·1 answer
  • Antarctica is covered in ice. Which of the following would you expect to be true of Antarctica? A. The ice reflects no radiation
    11·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The graph above shows global surface temperatures from 1845 to 2005. Which is least likely the cause for the increase in surface
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!