The statement is true. DNA replication process happen during the cell cycle.
Analogous structures have a different evolutionary ancestries but they have the same function
while homologous structures are the opposite; they have similar ancestries and common traits but maybe not have the same function in an organism
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The high heat capacity of water prevents fish body temperatures from changing during the winter.
