1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir2022 [97]
3 years ago
10

Two rodent populations become separated when a large canyon develops in a previously unbroken forest. When is allopatric speciat

ion between the two populations complete?
Biology
1 answer:
krek1111 [17]3 years ago
3 0

Answer:

Allopatric speciation occurs due to the geographical isolation between individuals of the same species. The geographical isolation can be due to canyon development, mountain formation, migration, etc.  

The geographical isolation gives different environmental condition to the separated population of same species to live which allow these two population to evolve differently and evolve in different species.

So when two population becomes different species and not able to interbreed with each other when give opportunity then the allopatric speciation between the two populations becomes complete.

You might be interested in
What happens in the G2 phase of the cell cycle?
expeople1 [14]

Answer:

A. Prepares for cell division

Explanation:

The S phase is when the DNA divides, so B is incorrect.

The post mitotic phase (G0 phase) happens before the cell divides, so C is incorrect.

5 0
3 years ago
Read 2 more answers
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
olchik [2.2K]

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

8 0
3 years ago
Which of the following is a good reason for why tobacco smoke is considered a carcinogen?
Mazyrski [523]
<span>it causes mutation leading to cancer </span>is a good reason for why tobacco smoke is considered a carcinogen
7 0
3 years ago
Read 2 more answers
Which of the following is not part of the modern cell theory?
yawa3891 [41]

Answer:

Each cell has a unique chemical composition

Explanation:

All the other answers are apart of the modern cell theory.

5 0
3 years ago
Dimples (D) and brown hair (A) are dominant traits. Answer the following questions based on the dihybrid cross shown:
ira [324]
1. DDAA, DdAa
2. DDaa, Dada
3. ddAA, ddAa
4. ddaa
5. The phenotypic ratio is 9:3:3:1 where 9 combinations will produce offspring with both dominant phenotypes (dimples and brown hair), 3 will produce offspring with one dominant phenotype and one receive phenotype (dimples, blonde hair), 3 will produce offspring with one receive phenotype and one dominant phenotype (no dimples, brown hair), and one will produce offspring with both recessive phenotypes (no dimples, blonde hair)
5 0
3 years ago
Other questions:
  • How are hosts and parasites related?
    10·2 answers
  • Viewed from earth, how does the moon's appearance the second week?
    14·1 answer
  • Many molecules are moved through the body by what?
    9·1 answer
  • Of the following, ________ can change local species diversity but not global species diversity.
    14·2 answers
  • Can someone please help me with this question?......
    7·2 answers
  • All of the following are problems that growth causes for cells except
    14·1 answer
  • Should you recommend changing fluids based on the color or smell of the fluid?
    9·2 answers
  • What was the procedure during the first successful vaccination?
    5·2 answers
  • Which of these is not an edible root?<br> a. Carrot<br> b. Turnip<br> d. Sweet notato<br> c. Ginger
    12·1 answer
  • What is an astronomical unit or AU?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!