1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alja [10]
3 years ago
13

What is the meaning of Demography? ​

Biology
2 answers:
LiRa [457]3 years ago
6 0

The study of statistics. Like the increase or decrease of things. For example birth rates or the size of the human population.

I hope this helps :)

avanturin [10]3 years ago
4 0

It is the study of the human population of a region statistically.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Which cells possess a nucleus l? What is the purpose of a nucleus and DNA found within it?
Westkost [7]

Eukaryotic cells posses a nucleus the purpose of the nucleus is it stores DNA which is the genetic material for the cell DNA acts as an instruction manual for the other organelles in the cell. While prokaryotic cells do not have a nucleus they still have dna but it’s floating around freely

3 0
4 years ago
Provide a specific example of photosynthesis and cellular respiration working together.
pshichka [43]
Photosynthesis makes glucose that is used in cellular respiration I think that’s how they work together
7 0
3 years ago
What forms When animal cells are almost finished dividing during telophase and is the point where they will split
salantis [7]

In telophase, the cell is nearly done dividing, and it starts to re-establish its normal structures as cytokinesis (division of the cell contents) takes place. The mitotic spindle is broken down into its building blocks. Two new nuclei form, one for each set of chromosomes.

4 0
4 years ago
Read 2 more answers
What occurs during the digestion of proteins?
madreJ [45]

Answer:

Specific enzymes break down proteins into amino acids

7 0
3 years ago
Other questions:
  • How long ago did the last ice age end
    10·1 answer
  • Please Answer!
    15·2 answers
  • I do not understand this question. If someone could explain it to me. I’ve circled the question I need help with.
    8·1 answer
  • How many species are currently considered “critically endangered”?
    9·1 answer
  • PLZ HELP is oxygen a fluid
    8·2 answers
  • Where are the youngest rocks found on this geological map?
    14·2 answers
  • Can the brain repair itself
    7·1 answer
  • If you use the letter E for this gene. what is the genotype of the offspring if the parents were EE x ee
    6·1 answer
  • Can a person be exposed to hiv by hugging or shaking hands with an infected person? a. yes, because the virus can be transmitted
    7·1 answer
  • The term for genetic testing on embryos for genes that cause untreatable or severe diseases is:________
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!