1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lukranit [14]
3 years ago
15

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Biology
2 answers:
Klio2033 [76]3 years ago
7 0
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Y_Kistochka [10]3 years ago
4 0

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

You might be interested in
Which specializes organelle is show ?
alexdok [17]
The “powerhouses” of the cell, mitochondria are oval-shaped organelles found in most eukaryotic cells. As the site of cellular respiration, mitochondria serve to transform molecules such as glucose into an energy molecule known as ATP (adenosine triphosphate).
4 0
3 years ago
Read 2 more answers
Common ancestry isn't the only reason for similarities between species. Similar traits can also arise if species experience simi
Dvinal [7]

Answer:

This process is known as: <em><u>convergent evolution</u></em>

Explanation:

Hope this help

Have a nice day!!!

7 0
3 years ago
By genetic modification and evolutionary processes, biodiversity is increased and decreased by habitat loss, population reductio
oksano4ka [1.4K]

Answer:

Genetic Modification is a procedure to change the qualities of a plant, creature or miniature life form by moving a bit of DNA from one living being to an alternate living being. This is done through focused expulsion of the ideal qualities from the DNA of one living being and adding them to the next living being. This strategy has for instance been utilized to create growths and microorganisms that produce drugs.

Evolution is the cycle by which current creatures have dropped from old progenitors. Evolution is liable for both the surprising similitude we see over all life and the astonishing variety of that life.

Explanation:

Evolution is change in the heritable qualities of organic populaces over progressive ages. These attributes are the statements of qualities that are given from parent to posterity during generation. Various attributes will in general exist inside some random populace because of transformation, hereditary recombination and different wellsprings of hereditary variety. Evolution happens when transformative cycles, for example, regular choice (counting sexual choice) and hereditary float follow up on this variety, bringing about specific qualities getting more normal or uncommon inside a populace.

It is this cycle of development that has offered ascend to biodiversity at each degree of natural association, including the degrees of species, singular life forms and atoms.

8 0
3 years ago
In this process, a stem from one plant is attached to the stem of another plant, and they are allowed to grow together.
LenKa [72]
The answer is A i hope this helps if it is wrong im so srry
6 0
3 years ago
Help needed.
worty [1.4K]

Answer:

I believe the answer would be (e).

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • At what temperature will water begin to boil and turn to steam?
    14·1 answer
  • Down syndrome is a condition in which the individual
    15·1 answer
  • When using patient management, how would a clinician indicate that the treatment plan for a specific patient problem was working
    15·1 answer
  • Esther would like to gain weight, but despite eating regular meals and having no disordered eating practice or eating disorder,
    11·1 answer
  • Will give 20 points!
    10·2 answers
  • Choose the best location for obtaining a red bone marrow sample from a patient. 14) A) medullary cavity of femur C) hip bone B)
    6·2 answers
  • How long does it take for food to digest?
    15·1 answer
  • Because the fish are now able to swim in deep water, their ___________ in shallower water will have less food. Likewise, competi
    8·1 answer
  • What type of water produces an electric current? =
    13·2 answers
  • Compare the processes by which a car and a human use "fuel" to perform work. What are the similarities?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!