1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lukranit [14]
3 years ago
15

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Biology
2 answers:
Klio2033 [76]3 years ago
7 0
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Y_Kistochka [10]3 years ago
4 0

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

You might be interested in
What did Leeuwenhoek use that enabled him to see bacte
masya89 [10]
The answer is different magnification lenses.  Leeuwenhoek use a microscope with different magnification lenses which enabled him to see bacteria. <span>His microscope was able to achieve 50-300x magnification, which enabled him to see a variety of bacteria.</span>
3 0
4 years ago
Read 2 more answers
What best describes a result of the hydrogen bonding between water molecules
makvit [3.9K]
The hydrogen bonding creates a dipole between the H and O atoms where the O "hogs" most of the protons 
6 0
3 years ago
What is the name of the part of the peripheral nervous system that controls voluntary movement of skeletal muscles?
Flura [38]
Striated muscles ruhhhhh
7 0
3 years ago
What is the difference between prophage and viral DNA?
mylen [45]

Answer:

A bacteriophage is a type of virus that attacks bacteria.  In the lytic cycle, the virus hijacks the cell machinery of the bacterium that it has infected. In the lysogenic cycle, the viral DNA is incorporated into the bacterial DNA.

Explanation:

Its a type of virus.

5 0
3 years ago
Read 2 more answers
9. Metals are known to
zimovet [89]

Explanation:

c.conduct heat and electricity well

6 0
3 years ago
Other questions:
  • Question 32 ribosomes carry out dna-directed protein synthesis. carry out rna processing are not found in prokaryotes. of mitoch
    5·1 answer
  • Hector is back from his morning run and is feeling lightheaded because his energy is depleted. Which food item will provide him
    12·2 answers
  • Meiosis contributes to the process of reproduction by producing what type of cell?
    9·2 answers
  • Your 83-year-old uncle has always been an entertaining storyteller. In the past few years, he has been having difficulty remembe
    7·2 answers
  • you notice a sign in a parking structure that says "Warning: This area contains chemicals known to the state of California to ca
    6·2 answers
  • As a research scientist, you measure the amount of ATP and NADPH consumed by the Calvin cycle in one hour. You find that 30,000
    11·1 answer
  • Help me guyzzzz!!!!!!!!
    14·1 answer
  • What is sexual reproduction?
    14·2 answers
  • Do you think that organisms of the same order will share a stronger evolutionary relationship than organisms that share only the
    14·1 answer
  • Male birds of paradise are known for having bright markings that they flash while making complex movements when females are near
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!