1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elden [556K]
3 years ago
6

The image shows rock strata from three different regions on Earth. Identify all the layers that contain an index fossil

Biology
1 answer:
FrozenT [24]3 years ago
7 0

The correct answer is: Layer 1, layer 2, and layer 4 in all three regions.

The index fossils are fossils that are commonly used for identifying a geological period of time, and these fossils are also very wide spread, as well as having a rapid evolutionary trends.

By this picture, we can easily see that even though we have rock strata from different regions, the same layers contain the same fossil, and it is a fossil that also is rapidly evolving so has a minor change in each layer.

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Which electrical device runs on direct current
balandron [24]

Answer:

A converter

Explanation:

5 0
2 years ago
During exercise, energy demand in the muscle increases. Which other body system directly provides for this demand
beks73 [17]
The body system that directly provides for this demand is the circulatory system. When you exercise, the circulatory and muscle system cooperate, in order to meet the increased needs for strength and energy. The circulatory system involves the network which delivers blood to every part of your body. This flowing of blood ensures that the tissues are oxygenated and rich in necessary nutrients. During exercise, more blood flows to and from your muscles, in order to deliver the necessary amounts of oxygen to complete the aerobic respiration.
8 0
3 years ago
Read 2 more answers
Help please AYUDAAAAAAAAAAA
vampirchik [111]

Answer:

answers (B) numnut

Explanation:

8 0
2 years ago
Populations of blue-winged warblers, a type of bird, migrate south in the winter and return to Canadian breeding grounds in the
Vladimir [108]

Answer:

Populations will decline.

Explanation:

Since individuals will be less likely to successfully reproduce, and because they will not be able to breed with other birds on the breeding grounds.

Hopefully this helps :)

6 0
2 years ago
Other questions:
  • What is the by-product of digestion
    11·1 answer
  • What is the term for the traditional ritual by which officers in UK's Royal Navy are retired?
    7·2 answers
  • Which feature distinguishes prokaryotes cells?
    6·1 answer
  • The graph of a function increases twice as much over each subsequent equally sized interval. Which of the following could be the
    14·2 answers
  • Please help is a b c or d ?​
    11·2 answers
  • Niches help reduce _____. A.interspecific competition B.intraspecific competition C.cooperation D.mutualism
    6·2 answers
  • Malonate is a competitive inhibitor of succinate dehydrogenase. If malonate is added to a mitochondrial preparation that is oxid
    11·1 answer
  • What are the errors in the table? Check all that apply.<br> HELP PLS ASAP
    10·2 answers
  • How does the active compound in poison ivy protect the plant from predators?
    12·1 answer
  • I need help ASAP marking braniiest
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!