Answer:
<h2>
A. precipitation</h2>
Explanation:
because the after evaporation and condensation
it rains which is precipitation
Answer:Enzymes that makes redox reactions possible in a biochemical process includes those that help to catalyze the transfer of electrons, atoms, or functional groups.
Explanation:
Here are some class categories of these enzymes and their roles ;
• Oxidoreductases - Transfer of electrons (hydride ions or H atoms)
• Transferases - Group- transfer reactions
• Hydrolases - Hydrolysis reactions (transfer of functional groups to water)
• Lyases - Addition of groups to double bonds, or formation of double bonds by removal of groups Transfer of groups within molecules to yield isomeric forms
• Isomerases - Formation of C-C, C-S, C--0, and C-N bonds by condensation reactions coupled to ATP cleavage
The above are however classified, given code numbers, and assigned names according to the type of transfer reaction, the group donor, and the group acceptor.
8 A and Idk the other one
Answer:
9 years
Explanation:
Boa constrictor: 30 years
Boa constrictors are native to North, Central, and South America, mainly dwelling in rainforests. The lifespan for the large, heavy-bodied snake averages about 20 years in the wild, but living in captivity can increase that by 10 to 15 years.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
