1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
3 years ago
15

The ears and stomach help the body fight

Biology
2 answers:
r-ruslan [8.4K]3 years ago
6 0

Answer:

The Ear creates ear wax to blocks germs from entering and the stomach destroy's germs that enter through the mouth

Explanation:

olga nikolaevna [1]3 years ago
5 0

Answer:

It going to be your gut that helps the ears and stomach fight the body

Explanation:  

<em>#CarryOnLearning</em>

<em>#StaySafe</em>

You might be interested in
Interest in protecting biodiversity is a relatively recent movement that coincided with the onset of global warming.
DerKrebs [107]
The statement is true.
3 0
3 years ago
Read 2 more answers
How far is the sun?<br> ölmfnf
Vesnalui [34]

Answer:

147.5 million km

Explanation:

The Sun is at an average distance of about 93,000,000 miles (150 million kilometers) away from Earth. It is so far away that light from the Sun, traveling at a speed of 186,000 miles (300,000 kilometers) per second, takes about 8 minutes to reach us.

4 0
3 years ago
The graph below shows the speed of a ball rolling over uneven ground.
Alex787 [66]

Answer:

It is Distance (meters)

between seconds 3 and 4

Explanation:

I had this on my test last week

7 0
3 years ago
Match each blood vessel with a fact.
Nookie1986 [14]
A. Veins 
B. <span>Arteries
C. </span><span>Capillaries</span>
4 0
3 years ago
Identify an appropriate control that the researchers should use when they study the growth and photosynthetic ability of the pla
natka813 [3]
The plant should remain the same
5 0
3 years ago
Other questions:
  • During the process of_____,a molecule such as glucose must use a protein channel to cross through a cell membrane.
    10·1 answer
  • What is the second major source of elements in seawater?
    12·2 answers
  • Which of these is always part of using the scientific method?
    15·1 answer
  • I NEED HELP. PLEASE SOMEONE HELP ME. What makes an allele dominate, recessive, or codominant?
    6·1 answer
  • Stellar evolution is _____.
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which of these agricultural practices is sustainable?
    11·2 answers
  • Law of Universal Gravitation says that there is a gravitational pull between all objects in the universe. The amount of that gra
    7·2 answers
  • What other cause is effecting the increase in floating algae?
    15·1 answer
  • I need help on cell cycles..
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!