All categories

3 years ago

Which is not a function of a vacuole

Biology

2 answers:

Bezzdna [24]3 years ago

5 0

Your answer is Packing Material.

I did the same quiz thingy

Anestetic [448]3 years ago

3 0

i believe its packing of materials

You might be interested in

AUUUAACUGUUCUGUCUAGAG

Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0

3 years ago

suppopse you were going to deisgn a system for the rapid diffusion of oxygen across a phosphlipid bilayer. according to fick's l

Llana [10]

Answer:

According to Fick's law, the rate of diffusion of any substance across any barrier is<u> directly proportional to the surface area of the membrane or any layer exposed. and the concentration of the diffusing substance available, but the rate is inversely proportional to the diffusion distance available.</u>

<u />

Thus the rate at which oxygen will move across the phospholipid bilayer will depend on the concentration or amount per mole of the oxygen molecule hitting the phopholipid at a prticular time and how permeable the phospholipd layer is to oxygen molecules, but the rate of its movement across will be reduced as the distance between the phosphoslipid bilayer and the diffusing molecules increases.

Therefore, the concentration of oxygen should be maximised, the surface area of the phospholipid bilayer should also be maximized. the distances between the phopholipid and the vessel containing the diffusing oxygen molecules should be drastically reduced. With this Fick's law has been applied , and therefore maximum oxygen molecules can diffuse across.

Explanation:

5 0

3 years ago

Which section of the heart receives deoxygenated blood? select one:

Tatiana [17]

Answer:

The right atria

Explanation:

The heart is the core organ of the circulatory system responsible for pumping blood by the contraction of cardiac muscles which is then conveyed to other parts of the body through blood vessels. The heart possesses four chambers of which the two upper ones are called ATRIA and the two lower ones are called VENTRICLE.

Each side of the heart contains one atria and one ventricle. The atria allows blood into the heart while the ventricle allows blood out of the heart. However, during the pumping process, deoxygenated (without oxygen) and oxygenated (with oxygen) blood enters and leaves the heart. The right ATRIA is responsible for receiving deoxygenated blood into the heart while the left ATRIA receives oxygenated blood into the heart.

3 0

3 years ago

Girl come for no age limit

Levart [38]

Answer:

another who will do my homework!

8 0

3 years ago

Read 2 more answers

2. Species that evolve in different locations but similar environments can appear similar. This is known as

zhenek [66]

Answer:

The correct option is A.

Convergent evolution is one of the defined type of evolution and it is shown by the species belonging to different ancestors show similar characteristics due to the same residing environmental condition.

Explanation:

The creation of analogous structure takes place in the process of convergent evolution. This is illustrated by the occurrence of similar structure in two different species which were not observed in their respective ancestor. This is due to the residence of the associated species in the same environmental condition and facing the same problems of livelihood. One of the most common example is the flying ability of the insects, bats and birds.

4 0

3 years ago