1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allisa [31]
3 years ago
9

The stems and for called bromelai vegetables brou and fruits of pineapple plants contain a group of protein-diresting enzymes co

llectively melain and often used as an anti-browninp agent for frujte and ds an anti-browning agent for fruits and vegetables, Fruits and bles brown when they are bruised during transport or sliced and exposed to air. This browning is olled by enzymatic pathways that produce brown pigments. The browning of fruits and stables reduces the nutritional value of the food, so anti-browning agents such as bromelain are controlled by enzi used.
(a) Identify the type of monomer of which this enzyme is composed.
(b) Bromelain works by breaking the enzymes that cause browning into smaller molecules. Explain how the reaction that breaks up the enzymes occurs.
Biology
1 answer:
lys-0071 [83]3 years ago
7 0

Answer:

a .Bromelain extract is a blend of protein-processing (proteolytic) chemicals and a few different substances in littler amounts. The proteolytic catalysts are sulfhydryl proteases; a free sulfhydryl gathering of a cysteine amino corrosive side chain is required for work. the monomer of this enzyme is aminoacid.

b.Bromelain isolates the amino acids in the compounds that cause browning by breaking the peptide bonds.

You might be interested in
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Order the steps to show how energy is transformed in plant cells.
il63 [147K]

Answer:

1,3,2 and 4 is the correct formation

Explanation:

8 0
3 years ago
Read 2 more answers
Which 3 kingdoms that have some motility?
larisa [96]

Explanation:

KingdomMonera,Kingdom Protista,Kingdom Animalai.

3 0
3 years ago
Analyze the result of a cross between two organisms that are both heterozygous for two different genes (AaBb) use a Punnett squa
krok68 [10]
(1) All the genotypes are as follows: AABB, AaBB, AABb, AaBb, aaBB, aaBb, AAbb, Aabb, aabb.

(2) Assuming that Aa is dominant and Bb is recessive, there will be 9 phenotypes with both A and B allele dominant (i.e. AaBb, AABb); there will be 3 phenotypes with just the A allele dominant (i.e. Aabb, AAbb); there will be 3 phenotypes with just the B allele dominant (i.e. aaBb, aaBB); and there will be 1 phenotype with both alleles recessive (i.e. aabb). The phenotypic ratio in this case is 9:3:3:1.

(3) The probability of producing an offspring with the aabb genotype is 1/16 or 6%.

4 0
4 years ago
Which of these is rich in unsaturated fats? which of these is rich in unsaturated fats? butter lard olive oil beef fat a fat tha
serg [7]
Butter, lard and beef fat are all rich in unsaturated fats :)
7 0
3 years ago
Other questions:
  • Phytoplankton would most likely be found _______.
    5·2 answers
  • Describe how changes in an ecosystem can affect organisms that live there.
    10·2 answers
  • One steep slopes and mountains helps reduce erosion by creating level areas for crops
    7·2 answers
  • 1. Choose an element (1-20 ) from the periodic table.
    8·1 answer
  • What type of hormone usually travels in the blood plasma bound to a protein?
    6·1 answer
  • Can you tell me the answer to 69+420​
    9·2 answers
  • Most fungi live by decomposing the remains of plants, animals, and microbes found in soil. that is why most fungi are called
    9·1 answer
  • What happens in animal cells when mineral concentration is high and low in solution
    14·1 answer
  • Compose a three to five-sentence paragraph that discusses reasons Hannibal could use to convince his friend that mushrooms are f
    7·1 answer
  • The Big Bird lineage became reproductively isolated from G. fortis. Describe one prezygotic mechanism that likely contributed to
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!