<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
1,3,2 and 4 is the correct formation
Explanation:
Explanation:
KingdomMonera,Kingdom Protista,Kingdom Animalai.
(1) All the genotypes are as follows: AABB, AaBB, AABb, AaBb, aaBB, aaBb, AAbb, Aabb, aabb.
(2) Assuming that Aa is dominant and Bb is recessive, there will be 9 phenotypes with both A and B allele dominant (i.e. AaBb, AABb); there will be 3 phenotypes with just the A allele dominant (i.e. Aabb, AAbb); there will be 3 phenotypes with just the B allele dominant (i.e. aaBb, aaBB); and there will be 1 phenotype with both alleles recessive (i.e. aabb). The phenotypic ratio in this case is 9:3:3:1.
(3) The probability of producing an offspring with the aabb genotype is 1/16 or 6%.
Butter, lard and beef fat are all rich in unsaturated fats :)