Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer is D.
Waste products from metabolism are carried by the circulation to the kidneys, which filter them out if the blood to be excreted in urine.
It is true that it is possible for a population to not evolve for a while.
There is something called the Hardy-Weinberg theorem, which characterizes the distributions of genotype frequencies in populations that are not evolving.
There are 5 Hardy-Weinberg assumptions:
- no mutation
- random mating
- no gene flow
- infinite population size
- and no selection (natural nor forced).
You can see that some of these are kinda extreme and really hard to get, but with approximations, we can work.
For example, instead of an "infinite population size" we have enough with a really large population, such that genetic drift is negligible.
Concluding, yes, it is possible (but really difficult) for a population to not evolve for a while (at least, in nature), as long as the 5 assumptions above are met.
If you want to learn more, you can read:
brainly.com/question/19431143
I do not believe it is possible for long periods of time. If the intestines are still intact, one can live for up to a certain period of time without medical help. However, this is an extremely short period of time.
Answer:
An adaptation.
it's trying to stay safe from predators in the same way it feeds.
