1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cloud [144]
3 years ago
5

Which is the MOST difficult to fossilize? A) fish B) mammals C) plants D) snails

Biology
2 answers:
vazorg [7]3 years ago
8 0
A fish is the hardest to fossilize
jolli1 [7]3 years ago
4 0
The answer is D. snails
You might be interested in
How would this hypothesis different from the scientific law
densk [106]
What hypothesis ????????
4 0
3 years ago
The diploid number of chromosomes in humans (homo sapiens) is 46 and the diploid number of chromosomes in rice (oryza sativa) is
Mrac [35]

For humans, the diploid chromosome number equation is 2n = 46 because humans have two sets of 23 chromosomes The diploid chromosome number varies by organism and ranges from 10 to 50 chromosomes per cell.

<h3>What is Mitosis?</h3>

Mitosis is a type of cell division that occurs in somatic or body cells. In mitosis, and a cell undergoes division to produce two daughter cells each with the same number of chromosome as the parent cells.

Mitosis produces diploid cells and diploid cells are cells that have the same number of chromosomes as the parent cell.

Thus,  The diploid chromosome number varies by organism and ranges from 10 to 50 chromosomes per cell.

To learn more about chromosomes  click here:

brainly.com/question/296477

#SPJ4

8 0
2 years ago
How many of the organ systems are required to maintain homeostasis?
Harman [31]

Answer:

two

Explanation:

The endocrine and central nervous systems are the major control systems for regulating homeostasis

7 0
3 years ago
Select the correct answer.
Lena [83]
The correct answer is D, white blood cells.
We know that red blood cells deliver nutrients and are not apart of the immune system; platelets are responsible for coagulation, which has nothing to do with the immune system, and plasma is a substance that, again, has nothing to do with immunity. White blood cells are the only things that fight disease (antibodies are white blood cells)!

I hope I helped!

(By nothing I meant very little to none).
7 0
3 years ago
Read 2 more answers
What term means away from the midline of the body?
Lesechka [4]
The anatomical term meaning away from the midline is lateral
6 0
3 years ago
Read 2 more answers
Other questions:
  • Question 5 Multiple Choice Worth 2 points)
    15·1 answer
  • A cross-sectional view of a log shows a concentric pattern. Which part of the stem gives rise to this pattern? A. Phloem
    9·2 answers
  • I swear i litterly have minutes to get this done pllzz anyone out their answer promise to give brainlist plzzzzzzzzzzzzz i reall
    15·2 answers
  • What are the function of the male reproductive system
    13·1 answer
  • Which of the following is NOT a characteristic of all living things?*
    7·1 answer
  • Describe how mutations lead to genetic variations
    14·1 answer
  • What do the arrows tell us in a food chain?
    10·2 answers
  • Please help this is a 7th grade science problem
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • HELP ME SOMEONE PLSss
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!