1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
malfutka [58]
3 years ago
8

Plzz help me assap thx

Biology
1 answer:
tia_tia [17]3 years ago
6 0
The correct anwser should be speed





:)
You might be interested in
I've is less dense than water so it will?
katen-ka-za [31]
So it will float on top of the water
6 0
4 years ago
In a genome-wide expression study using a DNA microarray assay, each well is used to detect the
stiv31 [10]
The correct answer that would best fit the given statement above would be the third option. <span>In a genome-wide expression study using a DNA microarray assay, each well is used to detect the expression of a specific gene by a cell. Hope this answers your question. Have a great day!</span>
7 0
3 years ago
Pulls with a force of 50N and someone else pulls 45N opposite direction. What is the net force?
hram777 [196]

Answer:

5 N

Hope it helps

I am sur abt the answer

8 0
3 years ago
the couple is also concerned about their child inheriting hemophilia, another rare disease, which is x-linked. natalie’s brother
IgorC [24]

Hemophilia is a recessive X-linked condition and is inherited from parents. . The probability that Natalie and Daniel’s first child has hemophilia is<u> 1/4</u>, not 1/8. The statement is<u> false.</u>

<h3>What is an X-linked gene?</h3>

When talking about sex-linked genes, we refer to all those genes located in one of the sex-chromosomes and not in the somatic ones.

X-linked genes are the genes located specifically in the X sex chromosome.

Traits coded by these genes are inherited. This is, X-linked genes are transmitted from parents to children through generations.

According to this, X-linked genetic disorders will be inherited as well.

  • Men have a high probability of being affected since they only have one copy of the X chromosome.
  • In women, the effect of the mutation might be musk in heterozygous state if the mutation is recessive.

Hemophilia is a recessive X-linked disorder, which means it is coded by the recessive allele.

  • X+ ⇒ X chrosomosome with Dominant allele
  • X- ⇒ X chrosomosome with Recessive allele

<u>Genotype              Phenotype</u>

X+X+                   Healthy woman

X+X-                    Healthy carrier woman

X-X-                     Hemophilic woman

X+Y                      Healthy man

X-Y                       Hemophilic man

Let us make a pedigree of these families,

<u>Natalie's family</u>:

Mother         healthy carrier          X+X-

Father          healthy                      X+Y

Brother        hemophilic                X-Y  

Natalie         Healthy                     X+X- or X+X+  

Natalie has 1/2 chances of being carrier X+X- and 1/2 of being X+X+.

<u>Daniel's family</u>:

Mother         healthy carrier          X+X-

Father          hemophilic                X-Y  

Sister           hemophilic                X-X-

Daniel          Healthy                      X+Y

He has 1/2 chances of being healthy X+Y and 1/2 of being affected X-Y.

According to the product probability rule, if events A and B are independent from each other, the probability of occurrence of both events together is

P(A∩B) = P(A) x P(B)

In this case,

  • event A is Daniel being affected ⇒ 1/2
  • event B is Natalie being carrier ⇒ 1/2

P(A∩B) = P(A) x P(B) = 1/2 x 1/2 = 1/4

The probability that Natalie and Daniel’s first child has hemophilia is 1/4, not 1/8. The statement is<u> false.</u>

You can learn more about X-linked genes at

brainly.com/question/12420228

brainly.com/question/14704182

brainly.com/question/1387724

#SPJ1

7 0
2 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • How do hydroelectric dams emit greenhouse gases like methane without burning any fossil fuels?
    15·1 answer
  • what is a situation where an environmental factor that could influence natural selection and decrease genetic diversity?
    12·1 answer
  • What is one path carbon can take through the environment?
    13·1 answer
  • The left side of the heart receives blood from veins, transfers it to the chambers on the right side of the heart, which circula
    9·1 answer
  • African lungfish, which are often found in small, stagnant pools of fresh water, produce urea as a nitrogenous waste. What is th
    12·1 answer
  • Why some organisms can survive without food ingestion for several months but can not survive without oxygen for a few minutes?​
    7·1 answer
  • Codominance involves
    6·1 answer
  • Answer this question please!!!!!
    8·1 answer
  • The image below indicates that as the distance from a mid-ocean ridge increases, the age of sea-floor rock.
    12·1 answer
  • White blood cells can defend the body against invaders through
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!