1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
3 years ago
15

Migration is _______.

Biology
2 answers:
Len [333]3 years ago
5 0
<span> the seasonal movement of organisms between locations</span>
VARVARA [1.3K]3 years ago
3 0

the answer for this question is "D".

You might be interested in
Can anyone tell me the Plant taxonomy Of any 10 flowers with 1 line explanation of each one
olga2289 [7]

Plant taxonomy is the classification of a plant based on different levels (taxa) such as kingdom, division (phylum), class, order, family, genus, species.

<h3>What is taxonomy of ten flowers?</h3>

The taxonomy of few flowers is as follows:

  • For Rose flower ; Kingdom : Plantae, Division: Magnoliophyta, Class: Magnoliopsida, Order: Rosales, Family: Rosacea, Subfamily: Rosoideae, and Genus: Rosa, Species: Rosa gallica and Rosa canina.

  • For hibiscus flower: Kingdom: plantae, class: Magnoliopsida, Order: Malvales, Family: Malvaceae, Genus: Hibiscus L.

  • For Buttercup ; Kingdom: Plantae ; Division: Magnoliophyta ; Class: Magnoliopsida ; Order: Ranunculales ; Family: Ranunculaceae,Genus: Ranunculus.

  • For California Poppy: Kingdom: Plantae · Phylum: Spermatophyta · Subphylum: Angiospermae · Class: Dicotyledonae · Order: Papaverales, Family:Papaveraceae.

  • For Daffodil: Domain: Eukaryota · Kingdom: Plantae · Phylum: Spermatophyta · Subphylum: Angiospermae · Class: Monocotyledonae.

  • For sunflower: Kingdom; plante, Division;tracheophytes,Class;Magnoliopsida,Order; Asterales, Family:Asteraceae, Genus: Bellis L. – bellis, Species: Bellis perennis L.

  • For tulip: Kingdom; Plantae, Phylum;Spermatophyta, Subphylum;Angiospermae, Class;Monocotyledonae, Phylum:Spermatophyta, Domain: Eukaryota.

  • For balsam: Kingdom; Plantae, Division; Tracheophyta, Class; Pinopsida conifers,Order; Pinales pines, Family; Pinaceae pines, Genus Abies M., Species: Abies balsamea (L.).

Therefore, Plant taxonomy is the classification of a plant based on different levels (taxa) such as kingdom, division (phylum), class, order, family, genus, species.

Learn more about taxonomy here:

brainly.com/question/1304906

#SPJ1

8 0
2 years ago
What is the importance of the carbon dioxide (co2) cycle?
prohojiy [21]
The carbon cycle illustrates how carbon, which is found in all living and once living things, is cycled and recycled from organisms to the soil and back to living things...matter is neither created or destroyed so the carbon we find in us, etc is the same carbon found in the earth since its "birth"
6 0
3 years ago
Which does Earth's rotation affect? (5)
ivolga24 [154]

Answer:

the Earth rotates on its axis, circulating air is deflected toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere. This deflection is called the Coriolis effect. Click the image for a larger view. Coastal currents are affected by local winds.

6 0
3 years ago
Read 2 more answers
In the ocean how does water temperature change as depth increases
tatuchka [14]
When the upper water layers warm in the summer months, they become separated from deep water by a transition zone known as a thermocline. In a thermocline, the temperature decreases rapidly with small increases in depth. This phenomenon linking temperature change with depth is called temperature stratification.
7 0
3 years ago
Read 2 more answers
In order for a cell to divide successfully, the cell must first
earnstyle [38]

The cell must Replicate its DNA for the Daughter cell

5 0
4 years ago
Other questions:
  • How are iron bond form
    15·1 answer
  • Do you think acid rain also affect crops?
    11·1 answer
  • Humans have 23 pairs of chromosomes. In contrast, chimpanzees have 24 pairs of chromosomes and lack any pair resembling the long
    11·1 answer
  • The most active area for the absorption of nutrients into the body is the
    7·1 answer
  • In the canary bird, green feathers are the result of a dominant gene “G” and the cinnamon color is the result of the recessive g
    10·1 answer
  • What happens to animals that are deprived of oxygen?
    12·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Why the initial cost of production of GMO is high
    10·1 answer
  • How does the whisk fern differ from most other plants?
    6·1 answer
  • Why does a virus lethal to us not infect animals? I know that RNA viruses mutate at 10,000 to a million times faster than DNA vi
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!