1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
10

What supplies blood to heart muscle​

Biology
2 answers:
shepuryov [24]3 years ago
8 0

Answer:

The aorta.

Explanation:

The right coronary artery supplies blood mainly to the right side of the heart.

Ivanshal [37]3 years ago
3 0

Answer:

that would be Arteries

Explanation:

An artery is a vessel that carries blood away from the heart and toward other tissues and organs.

You might be interested in
ADD NOTE QUESTION GUIDE
kolbaska11 [484]

Answer:

In order to avoid confusion with the identification of organisms

Explanation:

5 0
3 years ago
What choice best describes a wind that is caused by a convection current?
lana66690 [7]

Answer:

the answer is actually c

Explanation:

Cold air is more denser than hot air because ,when cold air of some density, say 'd' is heated, the molecules/atoms move apart from each other and so the volume expands. i hope that helped you

5 0
3 years ago
Which two of the organisms shown below are most closely related? A) borago officnalis and Primula officnals
S_A_V [24]

Answer:

if same question on ed

its b

6 0
3 years ago
Read 2 more answers
Witch one of earths layers are the thinnest
mars1129 [50]
The earth is divided into four main layers: the solid crust on the outside, the mantel, the outer core and the inner core. out of them, the crust is the thinnest layer of the earth, amounting for less than 1% of our planet's volume. hope this helps!
6 0
3 years ago
Question 1 Life would cease to exist without energy from the sun or some other source.
malfutka [58]

Answer:

Q1) True

Q2) Metabolism

Q3) Physiological response

Explanation:

Q1) Energy cannot be created (first law of thermodynamics). Life needs an energy source to transform. Without the energy from the sun or any other sources, life would cease to exist. (True)

Q2) An organism chemical reactions consist, in general, breaking down complex molecules (catabolism) releasing energy or to form complex structures from simpler molecules (anabolism) which require energy . The total of this reactions is called metabolism.

Q3) Hibernation is physiological state of inactivity and metabolic depression in some organisms, which result as a response to low temperatures and unavailability of food.

5 0
3 years ago
Other questions:
  • In tropical climates, why is there heavy vegetation but poor soil?
    7·1 answer
  • Which of the following is not one of the five main groups of arthropods?
    12·2 answers
  • The carbon cycle activity sheet
    14·2 answers
  • What is the general 3-D shape of cellulose molecules?
    8·1 answer
  • This scientist established a set of criteria to determine if a microbe is the cause of a specific disease.
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • A young female is unconscious after intentionally ingesting a large amount of aspirin. You will MOST likely find her respiration
    15·1 answer
  • Please answer quickly
    14·1 answer
  • Which of the following is not true of viruses?
    11·2 answers
  • Which is a characteristic of a capillary? A. Carries blood away from the heart. B. Has valves to direct blood flow. C. Controls
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!