1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ZanzabumX [31]
3 years ago
11

Who knows the answer please

Biology
1 answer:
lions [1.4K]3 years ago
6 0

Answer:

D

Explanation:

The net force is zero and all the forces are balanced.

You might be interested in
A monitor visits a site conducting a Phase III study for an investigational drug to treat depression. The monitor is surprised t
satela [25.4K]

Answer:

sell the drugs to doctors  

Explanation:

only came for the points

7 0
3 years ago
The frequency of a wave does not change as it passes from one medium to another.
aleksley [76]

Answer:

B

Explanation:

6 0
3 years ago
Read 2 more answers
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
What three different genotypes are possible for an individual in this population
Nimfa-mama [501]

Answer:

With alleles 'A' and 'a' there are three possible genotypes AA, Aa and aa

Explanation:

Pls mark as brainliest answer

8 0
3 years ago
What benefit do offshore oil rigs have on the environment?
DerKrebs [107]
The correct answer is "The oil removed by this structure can be used to power ships."
Oil rigs are positive, effective and direct methods of recovering crude oil. It is a large construction on or in water with facilities to drill wells, to extract and process oil and natural gas, and to temporarily store product until it can be brought to shore for clearing and retailing.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Science and engineering techniques used to manipulate living cells to produce useful products
    14·1 answer
  • Reflect on all the illnesses anna garcia has experienced.did any of her illnesses studied this year result in a breakdown of her
    11·1 answer
  • What system is most active when you are at rest
    14·1 answer
  • What type of soul is the most permeable
    14·1 answer
  • Controlling voluntary skeletal muscles is a function of the __________ nervous system.
    7·1 answer
  • What did the Miller-Urey experiment demonstrate?
    13·1 answer
  • What are the base pairing rules, and how does nucleotide base pairing affect the structure of DNA?
    12·1 answer
  • In what stage does DNA synthesis occur? And what gets produced?
    11·2 answers
  • What do the skin and urinary system have in common?
    7·2 answers
  • Movement represents the integrated functioning of which three main body systems?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!