1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
never [62]
3 years ago
11

The light-dependent reactions include an electron transport chain system that works in a very

Biology
1 answer:
mamaluj [8]3 years ago
3 0

Explanation:

When the high energy electrons move from the reactive center, they are conveyed from one chain protein to another as the energy in the electrons is harnessed to pump H+ ions from the stroma into the lamellae. The electron will ultimately reduce NADP+ to NADPH and the electrons in the reactive center will be replaced by high energy electrons from the splitting of a water molecule in photolysis. The energy of the sun is used to split the water molecule. The high energy electrons then undergo the same cycle as the previous electrons and the cycle continues.

Eventually a proton-motive force is created across the lamellae membrane. This potential energy of the high H+ ion gradient is used by ATP synthase enzyme to phosphorylate ADPs to ATPs.  

Learn More:

For more on photosynthesis check out;

brainly.com/question/12131960

#LearnWithBrainly

You might be interested in
The graph below shows the speed of a ball rolling over uneven ground.
Alex787 [66]

Answer:

It is Distance (meters)

between seconds 3 and 4

Explanation:

I had this on my test last week

7 0
3 years ago
Which of these would be the most helpful when identifying a mineral?
hodyreva [135]
All of them, they are all very important factors to test for the identifying
3 0
3 years ago
Read 2 more answers
Whose ability to use fossils in stratigraphy was identified as a major breakthrough in
Alex777 [14]
William Smith and Georges Cuvier
4 0
3 years ago
4. Analyze the data presented in this graph of global climate data, which shows an anomaly (change) from normal temperatures. us
anastassius [24]
We’ve used modern web technologies, including WebGL graphics rendering and some clever code optimization, for blisteringly fast visualization.

Your users will enjoy excellent performance, on any device, where ever they are in the world.

KeyLines performance
3 0
4 years ago
Los agujeros negros no son negros. <br> Cierto<br> Falso
Ad libitum [116K]

Answer:

Correcto

Explanation:

5 0
3 years ago
Other questions:
  • Help what do I dooooooo
    5·1 answer
  • which of the following is not a property of a base? feel slippery to the touch change red litmus to blue have a sour taste produ
    14·1 answer
  • describe at least one reason for limiting each of the following in a well balanced diet saturated fat, cholesterol and sodium
    11·1 answer
  • Which method of weight training can be used to develop muscular strength?
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which trait is common to rocks formed from magma trapped inside a volcano?
    8·2 answers
  • Somebody please help me.<br>anyone with the right answer will get brainliest​
    9·2 answers
  • Which of these choices is the cytoskeleton's main structure? It provides support, structure, and
    12·1 answer
  • Please helpppppppp mee
    10·1 answer
  • Please help!!!!
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!