1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vichka [17]
3 years ago
14

Which numbered arrow represents the promoter for RNA II. RNA II serves as the primer for DNA synthesis for plasmid replication.

(The two fat arrows, blue (number 1) and red (number 4), represent promoters.)
Biology
1 answer:
Tema [17]3 years ago
3 0

Answer:

Number 1

Explanation:

You might be interested in
Red-green color blindness is an X-linked recessive disorder that is passed through generations and can be traced by using a pedi
Nostrana [21]

Answer:

Lisa and Monica

Explanation:

<em>The correct answer would be Lisa and Monica.</em>

<u>For X-linked recessive disorders, a female can be unaffected, a carrier, or affected. However, a male can either be affected or unaffected and never a carrier. This is because females have two X chromosomes while males have only one.</u>

In addition, completely filled-in shapes in a pedigree mean that such individuals are affected for the trait in question while half-filled shapes mean the individuals are carriers for the trait.

Hence, individuals in the pedigree that are labeled carriers for red-green color blindness are Lisa and Monica (they both have half-filled shapes).

8 0
3 years ago
Read 2 more answers
F cells were placed in a solution, and you observed them shrinking, the solution is probably _____
Sloan [31]

Answer: Hypertonic solution.

4 0
3 years ago
Which structure is the cytoplasm
emmainna [20.7K]

The nucleoid is a specific region found exclusively within the cytoplasm of a prokaryotic cell.

7 0
4 years ago
What is the similarity between toxicity caused by an overdose of acetylcholine or nicotine and by the use of ganglionic blockers
dem82 [27]

Explanation:

In neurology, postganglionic nerve fibers are autonomic nerve fibers from the ganglion to the effector organ. These, unlike preganglionic fibers (whose sole neurotransmitter is acetylcholine) have a variety of neurotransmitters to fulfill their functions.

Neurotransmitters

The neurotransmitters of postganglionic fibers are varied, and are distributed as follows:

In the parasympathetic nervous system, neurons are cholinergic (Acetylcholine is the primary neurotransmitter)

In the sympathetic nervous system, neurons are mostly adrenergic (norepinephrine-epinephrine and / or norepinephrine, both have the same chemical structure, but epinephrine has a methyl group unlike norepinephrine that has a hydrogen, instead of a methyl group - act as the primary neurotransmitter) Two exceptions to this are the sympathetic innervation of the sweat glands and the piloerector muscles where the neurotransmitter in both pre and post ganglionic synapses is acetylcholine and in the vessels of the renal cortex where dopamine is used as the main neurotransmitter. Another exception is the sympathetic innervation of the medulla of the adrenal gland, which is innervated by preganglionic fibers, and subsequently uses acetylcholine as a neurotransmitter. Adrenal medulla cells are, in fact, modified postganglionic neurons that secrete epinephrine and norepinephrine directly into the bloodstream rather than a synapse.

In both divisions of the autonomic nervous system, postganglionic neurons express nicotinic acetylcholine receptors to receive signals from preganglionic neurons.

6 0
3 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
Other questions:
  • Cold sores are caused by the herpes simplex virus type 1. a company that wants to develop antiviral drugs would ask a research i
    13·1 answer
  • Which term is correct for one female arctic fox?
    6·2 answers
  • Running is an activity that causes the cells in the muscular system to use oxygen at a faster rate. which system responds by del
    9·1 answer
  • How did British manufacturing give Great Britain an advantage in the war?
    11·2 answers
  • ______________ give your body energy
    5·1 answer
  • A female client has a history of frequent urinary tract infections (utis). to decrease the incidence of the infections, the nurs
    5·1 answer
  • List the body''s nonspecific defenses against pathogens?
    8·1 answer
  • Is dna synthesis apart of creating rna
    7·2 answers
  • How does earthquake bring about change in the topography of the earth
    14·1 answer
  • Saliva flows out of the salivary glands into your mouth is it diffusion osmosis or neither
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!