1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetach [21]
4 years ago
5

What advantage does sexual reproduction have over asexual reproduction in plants?

Biology
2 answers:
Llana [10]4 years ago
7 0
Sexual reproduction creates diversity in a species. In asexual reproduction, the parent passes down the same traits to the offspring, creating an clone by doing so. There are advantages to asexual reproduction, but a downside of it is that if a certain disease spreads around that only affects a plant or animal with a certain trait, the whole species is most-likely to die off. Sexual reproduction will mix traits from both parents, and because there is a chance that the offspring will not inherit the trait that makes them weak against the disease, the species will live and recover faster.
nexus9112 [7]4 years ago
5 0
Your answer is the advantage is that sexual reproduction crates more diversity and there fore different types of resistance against different treats. A-sexual reproduction makes the exact same copy, this means that if some sort of virus mutated to kill something that was asexual it would wipe out the whole entire species because that species did not have different characteristics.
You might be interested in
Clonal selection of b cells activated by antigen exposure leads to production of
rodikova [14]
leads to production of Plasma cells, which in turn, produce antibodies
8 0
3 years ago
How do viruses reproduce?
Naddika [18.5K]

Answer:

c. By infecting living cells

Explanation:

c. By infecting living cells

6 0
3 years ago
Read 2 more answers
The __ is a series of geologic processes in which rock can form, change form one type to another, be destroyed, and form again.
omeli [17]

Answer:

rock cycle

Explanation:

5 0
3 years ago
Mary has an itchy rash on the surface of her skin, and Rick has cut his finger on glass. Would either person benefit from applyi
Nady [450]

Whats your answer I cant tell you if there is no answer choices



5 0
3 years ago
Explain the criteria for categorizing phenomena as science (Consistent, Observable, Natural, Predictable, Testable, and Tentativ
Vladimir79 [104]

<u>Answer:</u>

  • <em>Consistency:</em> Consistency is the property of the phenomena where the result of the observation or experiment should be consistence. The degree of the variation between the observation should very low.
  • <em>Observable: </em>The outcome of the result of the experiment should be observable and the result should be record able.
  • <em>Natural:</em> For the happening of the event, it should be explainable with the reference of the natural events.
  • <em>Predictable: </em>The event should be able to predict that can be explained on the basis of the naturally occurring event.
  • <em>Testable:</em> the cause of the natural event should be able to tested on the basis of variable environment in controlled environment to draw the different result and a conclusion based on the result.
  • <em>Tentativeness: </em>the scientific theory should be such that it could be tested upon. With the development of science, the theory should be modifiable and even proven wrong.
8 0
3 years ago
Other questions:
  • DNA and RNA are both?
    7·1 answer
  • What component of acid rain kills plants and harms soil
    10·1 answer
  • Great Britain began colonizing Australia late in which century? 16th 17th 18th 19th NextReset
    9·2 answers
  • How are plantlike protists classified into different groups
    9·1 answer
  • The functional connectivity is greatest for which pair of species?
    6·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Two separate species of squirrels have evolved after being separated by the Colorado River's erosion of the Grand Canyon. What t
    14·1 answer
  • The sequential series of nucleotide triplets that are positioned in the A site of the ribosome during translation. A. Primary st
    10·1 answer
  • When DNA is damaged inside a cell, enzymes called ________ can cut out and remove the damaged sections.
    11·1 answer
  • A researcher is studying the plants and animals in a particular biome. The observations include ferns, large woody vines, monkey
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!