1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eimsori [14]
2 years ago
10

Which of the following is revealed by fossil evidence? species relationships blood type chromosome number

Biology
1 answer:
givi [52]2 years ago
8 0
Species relationships. People find similarities between fossils and modern organisms to connect to evolution and other factors.
You might be interested in
For most of the 19th century, which nation was the dominant power in the world?
DENIUS [597]
The answer to this question is D. Great Britain. Hope this helps.
7 0
3 years ago
Read 2 more answers
Which of the following is NOT evidence of chemical change?
alexgriva [62]

Answer:

it turns cold

7 0
3 years ago
give an example of what the failure on an organ have on other organ systems? pls write your answer short! Thanks in advance!
devlian [24]
Hey this is late, but if an organ fails, like for example the kidney fails right? So then it affects the heart. and so on, because the kidney helps clean the blood and your body needs blood.
8 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Learning At Home - Grade 7/Pre-AP Gr. 7 Science TWISD
aliina [53]

Answer:

the dogs secure there offspring by getting them food

Explanation:

4 0
3 years ago
Other questions:
  • In the carbon cycle, decomposition is the breakdown of a substance into simpler substances. What is the name for the process of
    11·2 answers
  • As a result of a failure of the twenty-first pair of chromosomes to separate during meiosis, aziz received three of these chromo
    7·1 answer
  • What is selective breeding!
    7·2 answers
  • What do all complex multicellular organisms have in common? a means by which to hold cells together regulatory gene networks tha
    8·1 answer
  • During the final stage of cellular respiration, 36 molecules of ATP are produced as proteins embedded in the membrane move hydro
    11·2 answers
  • Which of the following is a major disruptor of the carbon cycle?
    13·2 answers
  • 1. What is the importance of scope and delimitation in a scientific research?
    8·1 answer
  • How would someone with diabetes know they need medical help?
    5·1 answer
  • A woman who is a hemophiliac has a normal daughter. What is the daughter’s genotype? Show
    12·1 answer
  • PLEASE HELPPPP I don’t understand this one
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!