1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SashulF [63]
3 years ago
6

How are chromosomes best described during the s phase of interphase prior to mitosis?

Biology
1 answer:
siniylev [52]3 years ago
5 0

During the S-phase of the interphase stage, this is where DNA replication is ongoing. No changes yet in the cellular level but still at the molecular level of the DNA Thank you for your question. Please don't hesitate to ask in Brainly your queries. 
You might be interested in
Why are highly conserved proteins good for constructing phylogenies
Anton [14]
Phylogenesis is the evolutionary development of particular features of an organism as well as the diversification of organisms, which sets them apart from one another.
Highly conserved proteins are useful in constructing phylogenesis because proteins are made by genes. These genes contain the genetic material of the organism. If the genetic material is in good condition, it is easier to study and the relationship of the particular organism with others is easily studied.
3 0
3 years ago
When nitrogen oxides are released into the atmosphere from burning fossil fuels, _______________ occurs.
Nesterboy [21]

Answer:

acid rain

Explanation:

6 0
2 years ago
Read 2 more answers
why do scientist ask why? and how does developments in scientific thinking influence how scientific study is carried out
natulia [17]
<span>Science is a practice of gaining comprehension of the nature of materials and phenomena by gathering and evaluating evidence. A scientific study is based on an hypothesis, a theory of causality. As the body of scientific knowledge increases, the design of scientific studies is informed by previous discoveries.</span>
3 0
3 years ago
Which group of plants lacks true roots, stems, and leaves?
Firdavs [7]

Answer:

Nonvascular Plants

Explanation:

Hope this helps.

5 0
2 years ago
Read 2 more answers
PLEASE HELP ONLY 2 I CANT GET
ehidna [41]
1.) B it is not d because it shows a growth in the beak size, it didn't say anything about the birds having larger beaks just that the size increased
2.) A

p=.5 q=.5
q^2=.25 p^2= .25 2(pq)= .5  everything added up is 1.0 so we good

so q^2, which is the recessive gene or gg, is 25 percent
6 0
3 years ago
Other questions:
  • Approximately how many elements are there that combine chemically in a great number of ways to produce compounds?A.25B.50C.75D.1
    8·2 answers
  • A cells size is regulated by the ratio_________to____________
    14·1 answer
  • Is a very windy day. you are driving and a dust storm blows across the freeway reducing your visibility. you should drive slower
    14·1 answer
  • Terms in order from smallest to largest: species, biosphere, cell
    9·2 answers
  • Which two conclusions can be made about the animals from their embryo structure?
    5·1 answer
  • How do ants use formic acid to stay alive?
    5·1 answer
  • ​Which of the following statements is true regarding Cells A and B?
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which of the following is a reason a cell may divide:
    7·1 answer
  • What is the chromosome abnormality that causes down syndrome?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!