1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SashulF [63]
3 years ago
6

How are chromosomes best described during the s phase of interphase prior to mitosis?

Biology
1 answer:
siniylev [52]3 years ago
5 0

During the S-phase of the interphase stage, this is where DNA replication is ongoing. No changes yet in the cellular level but still at the molecular level of the DNA Thank you for your question. Please don't hesitate to ask in Brainly your queries. 
You might be interested in
Soils are part of our natural capital and all terrestrial life depends on it. most mature soils have about how many soil horizon
lisabon 2012 [21]
I believe that most mature soils have three soil horizons. That is Horizon A, Horizon B, and Horizon C. Horizon A, also called the top soil contains a mixture of mineral matter and organic matter, as well as many insects, fungi, and microorganisms. Horizon B, also called the sub soil, contains fine clay particles washed out of horizon A. Horizon C contains partially weathered parent material.
4 0
3 years ago
What type of reproduction results in new cells that are identical to the parent cell?
liq [111]
Asexual reproduction

8 0
3 years ago
An organism's ability to maintain a stable internal environment "in the midst of" external environmental change is known as
Lerok [7]

Answer:

It is d lol

Explanation:

Homeostasis.

7 0
4 years ago
Read 2 more answers
An aqueous solution in which the concentrations of hydrogen and hydroxide ions are equal; it has a pH of 7.0.
Levart [38]
Yes, a PH of 7 is considered neutral.
6 0
3 years ago
Read 2 more answers
Which organelle is the powerhouse of the cell
tekilochka [14]

Answer:

The mitochondria

Explanation: Mitochondria (sing. Mitochondrion) are known as the powerhouse of the cell because they are responsible for the release of energy from food ,i.e, cellular respiration. This energy is released in the form of ATP (adenosine triphosphate), the energy currency of the cell.

8 0
3 years ago
Read 2 more answers
Other questions:
  • What percentage of the human genome is truly unique to the individual and usable for DNA profiling?
    11·2 answers
  • Why do some people believe the human eye is an example of why evolution cannot be true
    11·1 answer
  • Is a tomato plant a whole organism?
    12·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • Pada pendapat anda mengapakah tapak kasut orang yang gemuk lebih cepat menjadi haus berbanding
    12·1 answer
  • What are the climate regions that great white sharks typically live in?
    10·1 answer
  • What are the 3C’s that plant cells have, but animal cells lack?
    7·2 answers
  • Plant cells have a large central vacuole that hold water and can swell, which then results in other cell organelles being pushed
    14·1 answer
  • What is a easy snacks that i can make fast​
    14·2 answers
  • "Since [the Silverleaf is] the closest relative of the [standard] sunflower, it should be perhaps reasonably straightforward to
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!