1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oduvanchick [21]
2 years ago
9

What is one way atmospheric nitrogen can be changed into ammonia?

Biology
2 answers:
Ilia_Sergeevich [38]2 years ago
7 0

The right option is; Lightning

Lightning is a way in which atmospheric nitrogen can be changed into ammonia.

Lightning is an extremely fast natural electrical discharge that occurs between a cloud and the ground, or within a cloud usually during a thunderstorm. Lightning can convert nitrogen molecules in the atmosphere into ammonia. Lightning allows nitrogen atom (N2) to react with oxygen (O2) to form nitrogen oxides, which then combine with water to form weak nitric acid (HNO3). Atmospheric nitrogen is released to the earth, and nitrogen is added to the soil in a usable form (such as nitrate). Within plants and other organisms, the nitrates are changed into amino acids and other important compounds.  


Pepsi [2]2 years ago
4 0
Your answer will be Lightning
Lightning converts nitrogen into ammonia that enters soil with rainfall
You might be interested in
How can evidence from an experiment be explained in relationship to the hypothesis
ra1l [238]

Answer:

it can be explained as a inference

Explanation:

7 0
2 years ago
Which of the following forest management practices keeps the forest in a state of mid to late succession?
kvv77 [185]

Answer:D SEED TREE CUTTING

Explanation:

The answer is seed- tree cutting. Edge2020

4 0
3 years ago
Read 2 more answers
When an economy is experiencing higher real interest rates, business firms will most likely be discouraged from investing in:
denis-greek [22]

Answer: specialized service

Explanation:

An economy experiencing high interest rates will have to reduce investment generally, BECAUSE higher rates increase the BORROWING and demands that ONLY investments with prospect of HIGHER RETURNS (i.e PROFITABLE) should be considered.

Thus, all options are profitable EXCEPT specialized services, as they would be considered a luxury (too costly)

7 0
3 years ago
What is the energy molecule in the thylakoid cell called ?
maria [59]
Your answer would be photosynthesis because photosynthesis synthesis  carbon based energy molecules from chloroplast inside a cell, with the outer membrance.

hope i helped my fellow brainily user :)
4 0
3 years ago
Describe two typical applications for each of the following types of microscope
Veseljchak [2.6K]
A.Transmission electron microscopes are a versatile tool for many fields, including medicine, biology, nanotechnology, metallurgy, forensics, electronics, material science, and much more. A biologist might use a TEM to look at the internal structure of a cell.

b. Industries including microelectronics, semiconductors, medical devices, general manufacturing, insurance and litigation support, and food processing, all use scanning electron microscopy as a way to examine the surface composition of components and products.

c.Brightfield Microscope is used in several fields, from basic biology to understanding cell structures in cell Biology, Microbiology, Bacteriology to visualizing parasitic organisms in Parasitology. Most of the specimens to viewed are stained using special staining to enable visualization.

d.A dissecting microscope is used to view three-dimensional objects and larger specimens, with a maximum magnification of 100x. This type of microscope might be used to study external features on an object or to examine structures not easily mounted onto flat slides.
5 0
2 years ago
Other questions:
  • Hemophilia is caused by the recessive allele on the X chromosome. If a mom is a carrier for hemophilia and dad does not have hem
    12·2 answers
  • Which adaption is likely to be common among prey species
    5·1 answer
  • Is cystic fibrosis an example of sex linked disorder
    10·2 answers
  • What are some mechanisms of variation
    15·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Instead of seeds, seedless plants produce cells called
    9·2 answers
  • Where does the humoral response happens
    11·1 answer
  • What causes different versions of the myostatin protein
    14·1 answer
  • Name some harmful substances found in cigarette smoke. How do these
    14·1 answer
  • Amphibians were diverse and abundant in the lush swamp forests of the ________, which is sometimes referred to as the age of the
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!