All categories

4 years ago

Coal is made from the remains of dead plants. It is made of carbon and other elements. Is coal a mineral?

2 answers:

soldier1979 [14.2K]4 years ago

6 0

Minerals are naturally-formed substances that have a specific chemical properties: abiogenic (minerals are not produced by or derived from living organisms, non-organic in origin), stable at room temperature (i.e. at 25 degrees C) , are represented by a known chemical formula , have an ordered atomic arrangement/structure. Coal is not classified as a mineral because it is an organic substance. Correct answer: D (coal is formed from the remains of dead plants and animals).

Marta_Voda [28]4 years ago

6 0

D No, because it is an organic substance. A mineral is "a solid inorganic substance of natural occurrence", therefore coal is not a mineral because it is organic, and minerals are inorganic.

You might be interested in

Why is an organism's variation important?

Lady_Fox [76]

D all the above are correct (don’t judge me if it’s wrong I did my best)put I’m positive it’s right

5 0

3 years ago

What is primary succession

vovangra [49]

Primary succession is one of two types of biological and ecological succession of plant life, occurring in an environment in which new substrate devoid of vegetation and other organisms usually lacking soil, such as a lava flow or area left from retreated glacier, is deposited. In other words, it is the gradual growth of an ecosystem over a longer period.

3 0

3 years ago

Read 2 more answers

Give 3 examples of how anions are named

AlekseyPX

Answer:...

Here are several examples of anions:

Bromide - Br -

Chloride - Cl -

Fluoride - F -

Iodide - I -

Nitride - N 3-

Oxide - O 2-

Sulfide - S 2

Explanation:

6 0

3 years ago

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0

3 years ago

If an organism has a vestigial structures that structure likely once had a function in a

nikitadnepr [17]

I’m sure the answer is early ancestor.

5 0

3 years ago

Read 2 more answers