1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir2022 [97]
3 years ago
15

What is the purpose of cellular respiration?

Biology
2 answers:
baherus [9]3 years ago
8 0
The Purpose Cellular Respiration. Cellular respiration is the processby which cells in plants and animals break down sugar and turn it into energy, which is then used to perform work at the cellular level. The purpose of cellular respiration is simple: it provides cells with the energy they need to function. - According to the website I went too. So I'm guessing it's "Produce usable energy - ATP". I hope this helped you! Good luck.
Delvig [45]3 years ago
7 0

It's C hope this helps!!

You might be interested in
Gas exchange in the lungs of mammals occurs in the __________.
Ronch [10]
It takes place <span>between the alveoli and capillaries, which are located in the walls of the alveoli.</span>
5 0
3 years ago
In young infants, the rooting reflex refers to the behavioral process where an infant will:
gogolik [260]
Rooting Reflex is a baby's tendency, when touched on the cheek, to turn toward the touch, open the mouth, and search for the nipple. Other behaviors include; sucking reflex; when an object is placed in the baby's mouth, he will begin to suck on it; grasping reflex; when touched on the palm of the hand, a baby will wrap his fingers tightly around the stimulus; moro reflex; infant startle response; when alarmed the baby will fling his limbs outward, then retract them and hold them close to his body. and also Babinski reflex; when stroked on the bottom of the foot, a baby will spread its toes.
4 0
3 years ago
What is the resistance of a 20-cm-long column of blood in this artery? assume that resistivity of blood is equal to 1.6 ωm.
Alinara [238K]
The way in which you need to solve this is by using the formula:
<span>R = ρL/A 
</span>That one is the formula that demonstrates <span>Resistance of a wire in Ω.
The formula can be explained like this: 
</span><span>ρ is resistivity of the material in Ω-m </span>
<span>L is length in meters </span>
<span>A is cross-sectional area in m² </span>
<span>A = πr², r is radius of wire in m 
As soon as you have your numbers, you can replace and proceed to get the asnwer</span>
7 0
3 years ago
The human genome contains about 3 billion base pairs. During the first cell division after fertilization of a human embryo, S ph
Nataly [62]

Answer:

5556

Explanation:

If a DNA polymerase synthesizes in average 50 nucleotides/second, that means that in three hours (10800 seconds) it synthesizes about 540000 nucleotides.

However, if the human genome is composed of 3000000000 (3 billion) base pairs (nucleotids), the minimum number of DNA polymerases (working in the same number of origins of replication) to finish the duplication of all the genome in three hours is 5555,5. (3000000000/540000). As we know there is no half polymerase, so we round to 5556.

5556 molecules of DNA polymerases acting on 5556  origins of replication are needed.

7 0
4 years ago
Read 2 more answers
A patient has been eating healthy foods but his digestive system is not doing what it usually does can this patient still exerci
Elanso [62]

Answer:

no

Explanation:

because you've never been able to

hey man sry if its wrong tbe question is almost weird to ask but yeah sry

3 0
3 years ago
Other questions:
  • Which process or stage occurs during incomplete metamorphosis?
    14·2 answers
  • Select the correct the answer
    9·1 answer
  • Although the plants are living, why cannot plants grow in the dark? g
    11·1 answer
  • Which percentage of Earth’s oceans is dissolved salts?
    15·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • In chickens, congenital baldness results from a Z-linked recessive gene. A bald rooster is mated with a normal hen. The Fi from
    7·1 answer
  • True or False: Within the body, all atoms combine to form molecules. If false, why?
    8·1 answer
  • A group of deer are part of the same species
    13·1 answer
  • How does the use of fertilizer affect the nitrogen cycle? Edge ​
    9·2 answers
  • PLEASE ASAP! GIVING BRAINLIEST!
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!