1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
3 years ago
12

To test for protein, you added Biuret solution and

Biology
2 answers:
BartSMP [9]3 years ago
8 0

Answer:

The water should not be pink/purple because water should test negative for protein.

The water should actually have turned blue, because Biuret solution is blue.

Someone may have mislabeled the test tube with water.

The water may have been contaminated with a protein.

Explanation:

OLEGan [10]3 years ago
7 0

Answer:

Water sample showing pink/purple color is an error.

Explanation:

Biuret is a blue color reagent that changes its color to pink/purple whenever it detects protein in a sample. Water don't contain proteins so it should not show pink/purple color instead it should maintain the blue color. Food items generally contain proteins so it show pink/purple color but it showed blue color.

Error might have caused by wrong marking of the samples, test tube marked with Water might contain a mystery food while Mystery food tube might contain water.

You might be interested in
9. All of the following statements about the scientific name for an organism are true EXCEPT
amid [387]

Answer:

D. the kingdom name is listed first

Explanation:

The genus name is listed first, not the kingdom name. The kingdom name isn't even is the scientific name.

5 0
3 years ago
If a magnet is attracted to a metal object what can you say about the pole of the magnet and the pole of the object?
Nikolay [14]

Answer:

A. The poles are opposite

Explanation:

Magnets are object that produce magnetic fields, which are regions of space that exert a forces on charged particles in motion or on other magnets.

Every magnet has 2 opposite poles, which are labelled by convention as North Pole and South Pole; the lines of the magnetic field of a magnet go out from the North Pole and go into the South Pole.

Magnetic poles always exist in pair: it means, every magnet always contains a North Pole and a South Pole. If a magnet is cut in a half, each half of the magnet will still have a North Pole and a South Pole.

Each pole exerts a force on another pole; in particular, we have:

- Like poles (north-north or south-south) repel each other

- Opposite poles (north-south) attract each other

In this problem, a magnet is attracted to a metal object: this means that the two poles must be of opposite polarity. Therefore, the correct option is

A. The poles are opposite

7 0
3 years ago
Mercury pollution in a local lake can be traced directly to a factory located near the lake's shore. What type of pollution is t
olga2289 [7]
It would be Primary because the lake is it’s starting point and the pollution grew all the way to the factory.
3 0
3 years ago
In Gottlieb's model, the probabilistic aspect of development refers to the idea that the characteristics of organisms at any poi
alexira [117]

Answer:   Determined by genetic and environmental factors.

Explanation:

Are determined by genetic and environmental factors and the interaction of such factors, but not with absolute certainty. This development system model includes both influences of species typical genes and the influences of a species typical rearing environment.   Relatively rapid increase in obesity, the change stems from changes in the environmental context.

6 0
2 years ago
Scenario 2 A young leaf needs water in order to perform the process of
Dmitriy789 [7]

Answer:

Vascular system - phloem and xylem

Explanation:

The phloem is responsible for translocating nutrient and sugars which are produced by the leaves to areas og the plant that are metabolically activew while the xylem cell wall transport water gom the root to the leaves.

However, a plant may have many xylem tissues extending up to the plant.

4 0
3 years ago
Other questions:
  • Is it risky using hair spray as a flame thrower?
    8·2 answers
  • In proteins, elements of secondary structure combine to form a(n)
    15·1 answer
  • 1)Water is said to have a high boiling point. How does this property of water allow for life in the oceans?
    6·2 answers
  • What is a cell membrane
    7·2 answers
  • What is trial-and-error behavior? Give an example.​
    14·1 answer
  • The meaning of CBC is
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The Disappearance of a population in a given niche as a result of direct competition with another species for a resource is call
    6·1 answer
  • The outer cell membrane is a type of exotoxin produced by bacteria. True False
    7·1 answer
  • a suspension of yeast cells is being grown under anaerobic conditions such that glucose is degraded to ethanol and carbon dioxid
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!