1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vagabundo [1.1K]
3 years ago
14

Why are carbon dioxide concentrations expected to increase?

Biology
1 answer:
garri49 [273]3 years ago
6 0

Answer:

The correct answer is d all of the above

Explanation:

There are many reasons behind increasing the concentration of atmospheric carbon dioxide such as

1 Burning of fossil fuels such as coal,petroleum increases the level of atmospheric carbon dioxide.

2 Increase in Argiculture also increases the level of green house gases such as CO2.

3 Clearing of lands for increasing population and agriculture by cutting down trees also adversely effect the normal 02:CO2 ratio in the atmosphere.

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
How is a dichotomous key and branching diagrams tools used different
LiRa [457]
Dichotomous Keys are used to find out what type of animal,plant,fungi,prokaryote,eukaryote,or bacteria an organism is. A branching diagram is used to find what domain,kingdom,phylum,class,order,family,genus,species an organism belongs in.
4 0
2 years ago
In the 1600’s which scientists discovered microbes in pond water by using a microscope
castortr0y [4]

Answer:

Anton Von Leeuwenhoek is the name

5 0
2 years ago
Plants produce all of the molecules they need for survival from inorganic compounds. Some elements, like nitrogen, come from the
olga55 [171]
Oxygon and Carbon from the atmosphere
6 0
2 years ago
Read 2 more answers
3 Explain why the average height of students is increasing in many parts of the world.​
denpristay [2]
<h2> The average height of people in different nations has  has increased approximately by 10 centimeters.</h2><h3>It mostly comes down to nutrition and child-rearing styles. </h3><h3>Some scientists believe that the increase in teenage and out-of-wedlock pregnancies in the developed world may be an unanticipated consequence of improved nutrition.</h3>

Tobacco smoking greatly increased over the last hundred or so years, but the old wives' dictum was always that "Smoking will stunt your growth!"

Hope this helped have a good day = )  .

6 0
2 years ago
Other questions:
  • What is scientific inquiry?
    7·1 answer
  • Flowers usuany contain more stamen than pistils. Why do you think this is?
    11·1 answer
  • Examples of different ways that observations can be used in scientific inquiry
    11·1 answer
  • The Taj Mahal in India is made of pure white marble. It is slowly losing its white color because of pollutants from vehicles and
    8·2 answers
  • The primary function of protein in the diet is to serve as
    5·1 answer
  • Name a land animal that is sessile. Why would this
    5·1 answer
  • What aspect of the dna molecule encodes hereditary information concerning an organism's traits?
    6·1 answer
  • Which of these has the greatest affect on blood flow ?A)radius of vessel B)length id vessel C)blood viscosity D) pressure gradie
    5·2 answers
  • Most protists are______.<br> A)Unicellular<br> B)Heterotrophs<br> C)Autotrophs<br> D)Multicellular
    12·1 answer
  • The embryonic period begins with ____ and lasts until the _____ week
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!