1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Misha Larkins [42]
3 years ago
9

Drinking too much water during exercise can cause a condition in which the concentration of sodium in the blood is lower than no

rmal. What response do you expect to happen as the body tries to restore homeostasis?
Biology
2 answers:
stiv31 [10]3 years ago
4 0
Your body may do several things to decrease the amount of water. This includes sweating, urinating, or even vomiting. Too much water could also cause stomach cramps.
MArishka [77]3 years ago
3 0

Answer:

Excess of transpiration and cramps.

Explanation:

Drinking too much water during excercise will lead to the body response of finding the way to recuperate homeostasis. Other than liberating more water than in a normal situation, the body will tend to have cramps; not only stomach cramps but cramps in the extremities.

The reason is that this low amount of sodium also results in a small amount of potassium and with the excess of water liberated by transpiration, most of all extremities will tend to have cramps.

You might be interested in
Organisms that obtain energy by eating nutrients that make up other organisms are called:
balu736 [363]

The organisms that obtain energy by eating nutrients that make up other organisms are called Hetertrophs. The correct answer between all the choices given is the second choice or letter B. I am hoping that this answer has satisfied your query about and it will be able to help you, and if you’d like, feel free to ask another question.

3 0
3 years ago
In which parts of the kidney are nephrons located?. . . . A.Renal vein and renal artery. . . . B.Renal pelvis and renal vein. .
Lunna [17]
Answer: C. Medulla and Cortex

The nephrons are found at the cortex-medulla junction. There are what we call as the juxtamedullary nephrons and cortical nephrons referring to their designated locations. The juxtamedullary nephrons are involved in the creation of concentrated urine of a person. 

4 0
3 years ago
Read 2 more answers
Which example is a trace fossil?
enot [183]

Answer:

B.) Dinosaur footprint

4 0
3 years ago
In eukaryotes , DNA is found in the cytoplasm of the cell
Paladinen [302]
In eukariotes, cells that have a neculeus, the dna is found in the neculeus, not the cytoplasim so that is false... I dunno if that is what u were asking...
5 0
3 years ago
What change would you expect to see in the atmosphere if we saw a decline in phytoplankton populations?
Alex17521 [72]
The concentration of CO2 would drastically increase.
4 0
3 years ago
Other questions:
  • When new cells are formed through the process of mitosis, the number of chromosomes in the new cells
    5·2 answers
  • 3 ways by which animals loose water to the atmosphere​
    10·1 answer
  • There are _____ levels of cell organization recognized by biologists.
    5·2 answers
  • The influence of how a mother’s nutrient intake may change gene expression to increase the infant’s development of obesity or ch
    12·1 answer
  • Which of these are included in the immune response? Check all that apply. T-cells lymphocytes B-cells phagocytes oil antibodies
    9·2 answers
  • Besides the Moon, the daily tides around the world are MOST affected by the
    9·2 answers
  • Scientists have determined that the codes for amino acids are?
    7·1 answer
  • Which of the following describes how the amount of available energy changes from one trophic level to another? A) Available ener
    15·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • 5 The systolic blood pressure reading of 140-159 the systolic blood pressure reading of 140 - 159 is what stage of Hypertension?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!