1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali5045456 [20]
3 years ago
10

Stomatas are pores on the plant leaf that control the flow of gases between the environment and the plant cells. This process he

lps the cells maintain a stable internal environment. Which biology theme does this example represent?
A.
interdependence in nature
B.
regulation
C.
energy transfer
Biology
1 answer:
nikdorinn [45]3 years ago
8 0

Answer:

regulation

Explanation:

stomata help regulate water loss

You might be interested in
Write the name of the organs found in middle ear with their function.​
sp2606 [1]

Answer:

tympanic cavity .. The primary function of the tympanic cavity is to offset the decrease in acoustic energy that would occur if the low impedance ear canal air directly contacted the high-impedance cochlear fluid.

Explanation:

6 0
3 years ago
PLS HELP ME QUICK, Name and Title:
olganol [36]

Answer:

Scenario One:

Scenario Two:

Scenario Three:

Was your hypothesis supported by your results or not? Explain how you know.

Explanation:

7 0
3 years ago
In mitosis of a single cell, what happens to the nucleus
Readme [11.4K]
A unique feature of the nucleus is that it disassembles and re-forms each time mostcells divide. At the beginning of mitosis, the chromosomes condense, the nucleolus disappears, and the nuclear envelope breaks down, resulting in the release of most of the contents of the nucleus into the cytoplasm.
Hope that helped
3 0
3 years ago
Which event was important to the beginning of Christianity?
iren2701 [21]

Answer:

probably the life and death of Jesus christ

3 0
3 years ago
Hair Coloring Experiment
leva [86]

The independent variable (hair<em> colorin</em>) causes a <u>response</u> in the dependent one (colorin <em>effectiveness)</em>. The constant variable <u>can not change</u> (<em>curly or straight</em>), the control variable is <u>kept constant</u> (<em>time and environmental conditions</em>). The experimental group receives the <u>treatment</u> (<em>40 students</em>).

------------------------------------------------

INDEPENDENT VARIABLE

Refers to all the variables in an experiment that provoke a response in another variable. The independent variable is modified to analyze its effects on another variable. The researcher changes on purpose the independent variable to observe the response of the dependent variable.

<em>In the exposed example, the independent variable is the red hair coloring </em>

<em>- Red Hair Paint</em>

<em>- L’Oreal</em>

DEPENDENT VARIABLE

Refers to the variable, which response depends on any change in the independent variable. The change in the dependent variable might be proportional or inversely proportional to the change in the manipulated variable.

<em>In the exposed example, the dependent variable is the coloring effectiveness, seen through how well the coloring takes and lasts. </em>

CONSTANTS

This variable does not change during the whole experiment and under any circumstance. It <u>can not change</u>.

<em>In the exposed example, the constant variable is the type of hair, curly or straight. </em>

CONTROL

Controlled variables are kept constant in the control groups and the experimental groups. Unlike the independent variable, the controlled variables do not influence the results. These variables do not affect the response of the dependent variable.

<em>In the exposed example, the controlled variables are the exposure time to the colorings and environmental conditions, such as temperature, humidity, etc.</em>

EXPERIMENTAL GROUP

The experimental group receives the treatment. The researcher apply different treatments to the experimental groups to observe how they affect the dependent variable. There can be several experimental groups.

<em>In the exposed example, the general experimental group is the 40 students' hairs. Because coloring does not have the same effect on different hair colors, the experimental group includes,</em>

<em>- 10 blonds, </em>

<em>- 10 brunettes, </em>

<em>- 10 with black hair</em>

<em>- 10 with red hair</em>

<em>-------------------------------------------</em>

<em>Related link: brainly.com/question/24653783</em>

5 0
3 years ago
Other questions:
  • Which statement is true about BRCA1 and BRCA2 genes?
    14·1 answer
  • Answer ASAP 50 points
    5·1 answer
  • Characteristically, a tumor that multiplies rapidly, is undifferentiated and invasive, and can metastasize is a ________ tumor.
    9·1 answer
  • How are Butterfly Wings and Brid wings different in form?
    12·1 answer
  • If two things go well together, we may say that they are ___________
    12·2 answers
  • How does mold help the forest? Pls help. I already have that Mold plays an important role in our environment because it breaks d
    14·1 answer
  • What movement of the thumb would be most affected by lesion of the median nerve in the cubital fossa
    14·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • cross a mom with no hitchhicker thumbs with a dad with hitch hiker thumbs complete the punnet square and detirmine the genetype
    8·1 answer
  • What are three types of information that geologists evaluate when they monitor volcanoes and warn of imminent eruptions?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!