Yes, the same codon does always control skin colour, eye colour and the presence of spots. Each codon codes for an amino acid in the organism. ... Since the the genetic code is universal this essentially means that almost all organisms build proteins with the same genetic code
A. is the best answer:
Bacteria typically have _one circular chromosome_, whereas eukaryotes have _many linear chromosomes_.
Answer:
By avoiding the factors due to which the disease occurs.
Explanation:
Seniors can combat health problems they may face by avoiding the factors which contribute in that health problems. For example, chronic disease occurs when the individual consume foods with more cholesterol so for reducing the risk of this disease the person should avoid the intake of food with high cholesterol levels. If they don't avoid the intake of such type of food so this disease may lead to death by closing the valves of the heart.
D hoped this helped you a lot! :s
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
