1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill115 [55]
3 years ago
7

Difference betweeen an earthquakes focus and epicentre

Biology
1 answer:
olga2289 [7]3 years ago
4 0
The epicenter is the outbreak of the earthquake
You might be interested in
Reproduction is a process by which an organism produces offspring, or young, and passes on its traits or characteristics. Mitosi
Ivanshal [37]

Answer:

D i think would be the best answer my studie in this part of health is low

6 0
3 years ago
Read 2 more answers
A molecule whose ends have opposite electric charges is called a _____ molecule.
horrorfan [7]
Magnetic Hope This Help=)
7 0
3 years ago
Read 2 more answers
The balanced equation for aerobic cellular respiration is ______________.
zaharov [31]

Answer:

C6H12O6 + 6O2-> 6CO2 + 6H2O

6 0
3 years ago
A bond formed by the electrical attraction between two oppositely charged ions is a(n)_____.
Ivanshal [37]


A bond formed by the electrical attraction between two oppositely charged is?

(B) IONIC BOND

<span>
</span>
6 0
4 years ago
Read 2 more answers
What is the name for a group of individuals of the same species living
inna [77]

Answer:

population is the right answer.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is a true difference between prokaryotic and eukaryotic cells?
    8·1 answer
  • During which stage is the placenta form completely???? Plz help I’ll give u the brain kissy answer
    11·1 answer
  • A benign tumor made up of newly formed blood vessels is known as
    8·1 answer
  • What are the four main spheres of the exterior of earth
    6·1 answer
  • Which best describes the interaction between dna and rna during protein synthesis? a rna carries the code to the nucleus where d
    5·1 answer
  • Which penguins don't migrate?
    13·2 answers
  • Which function would the energy releasing organelle most likely have in the animal
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • A somatic cell performs many tasks at once. Which is the most important factor that
    12·1 answer
  • How many positive particles does zinc have? *
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!