1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nikitich [7]
3 years ago
12

Compare and Contrast how electron transport is used to generate proton gradients in chloroplasts and mitochondria. Include more

specific details for more points.
Biology
1 answer:
Sergeeva-Olga [200]3 years ago
7 0

Electron transport chain (ETC) refers to a series of complexes involved in the transfer of electrons from electron donors to electron acceptors through the reduction and oxidation reactions.

The similarities between the ETC in mitochondria and chloroplasts are as follows-

1. Both involve the electron transport chains on their inner membranes.

2. The energy produced pumps the protons against their concentration gradient across a membrane.

3. ATP synthase is used.

4. Two protons provide energy for the production of three molecules of ATP.

The differences between the ETC in mitochondria and chloroplasts are as follows-

Mitochondria- It uses the process of oxidative phosphorylation and chemical energy from the reduction-oxidation reactions. The electron transport chain occurs in the cristae. The coenzymes involved include the NAD and FAD. ATP synthase is located in the cristae. The protons are pumped out of the matrix. The final electron acceptor is the oxygen.

Chloroplast- It uses the process of photophosphorylation and the light energy. The electron transport chain occurs in the thylakoid membrane. The coenzyme involved is the NADP. ATP synthase is located in the thylakoid membrane. The protons are pumped into the thylakoids. The final electron acceptor is the chlorophyll in cyclic photophosphorylation and NADPH+ in the non-cyclic photophosphorylation.





You might be interested in
All of the following are macromolecules except:
Harman [31]

Answer:

The correct answer is c. Fatty acids

Explanation:

There are four major types of macromolecules present in nature and that are carbohydrates(polysaccharides), proteins, lipids, and nucleic acids. These macromolecules are polymers and are made up of monomer units.  

The monomeric unit of polysaccharides is mainly glucose, of protein is amino acids, of nucleic acid is nucleotides and the monomeric unit of lipid is fatty acids. Ribosomes are macromolecules because it is made up of RNA  and proteins.

So fatty acid is a monomer which joins together to form large macromolecules like lipids. Fatty acids are made up of a hydrocarbon chain which have one attached COOH group at the terminal position.

Therefore the correct answer is c. Fatty acids.

6 0
3 years ago
How do the number of protons neutrons and the mass number relate to each other?
jek_recluse [69]
Mass number = protons + neutrons

If you have the # of protons and the mass #, subtract the number of protons from the mass number to get the number of neutrons.

If you have the number of neutrons and the mass number, subtract the number of neutrons from the mass number to get the number of protons.
5 0
3 years ago
Read 2 more answers
After the eighth week of pregnancy, the developing offspring is known as
Reika [66]
<span>Actually the developing offspring in the eight week of pregnancy is medically know as a fetus,Where the lungs of the baby are nearly developed, and baby continues to grow and mature, then reflexes of work starts woking slowly, after which baby prepares itself for delivery in next few days.</span>
4 0
3 years ago
What is the function of every generator<br> on Earth?
dimaraw [331]

Answer:basically changing mechanical energy into electrical energy

Explanation:

6 0
3 years ago
The cluster of developing cells from conception until birth is called what?
KatRina [158]
 the answer to that question is embryo
4 0
3 years ago
Other questions:
  • How much water should you have in a severe weather emergency supply kit?
    5·2 answers
  • Which term is defined as the change in physical state from liquid to gas at the surface of a liquid
    12·1 answer
  • Please help, I mark brainliest.
    13·1 answer
  • HELP ASAP PLEASE!!<br><br> A ___is a prediction based on data and information you researched.
    6·1 answer
  • If a liquid is heated, which of the following happens to both its energy content and the speed of its particles? The energy incr
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • In dna, one nucleotide monomer is linked to the next through _____. ( module 10.2)
    9·1 answer
  • DNA has two strands.If the sequence of the nucleotides of one strand was known,is it possible to use that information to determi
    14·1 answer
  • Choose the sentences that are related to the term solstice. Choose the two correct answers A it occurs in the spring B it occurs
    14·1 answer
  • How is malnutrition and obesity related to macronutrients/micronutrients?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!