Answer is B. Best way to check is make a square
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Its is to remove liquid waste from the blood in the form of urine, and keep a stable balance of salts and other substances in the blood and produce erythropoietin, hormone that is the formation of ref blood cells. The kidney remove ursa from the blood through this filtering units called nephrons
<span>The answer would be: a. inflammation is accompanied by an increase in peristaltic movements of his small intestine.
The pathogen will attract the white blood cells that will induce inflammation in the intestine. Inflammation of the intestine will cause increased permeability and increased bowel movement, makes the food transit time reduced and lead to diarrhoea. This mechanism is beneficial since it can help the intestine to "flush out" pathogen of toxins that induce the inflammation.</span>
