1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tcecarenko [31]
2 years ago
8

Describe a food chain of which you are a member.

Biology
2 answers:
RSB [31]2 years ago
4 0
sun , grass , beef ,and me.
atroni [7]2 years ago
3 0


I'll pretend I am the main producer of the food chain - The grass :D


Grass

\        /

Zebra

\       /

 Lion

You might be interested in
A(n) _________ scan uses radioactive markers in the blood to monitor blood flow and metabolic activity via x-ray.
olya-2409 [2.1K]

Answer;

-PET scan

A PET scan uses radioactive markers in the blood to monitor blood flow and metabolic activity via x-ray

Explanation;

-A positron emission tomography (PET) scan is an imaging test that helps reveal how the tissues and organs are functioning. A PET scan uses a radioactive drug (tracer) to show this activity. This scan can sometimes detect disease before it shows up on other imaging tests.

-A PET scan is used to diagnose certain health conditions, to plan treatment, to find out how an existing condition is developing, and to see how effective a treatment is.

-In a PET scan, a machine detects radiation that is emitted by a radiotracer. A radiotracer consists of radioactive material that is tagged to a natural chemical, such as glucose.

7 0
3 years ago
Read 2 more answers
Why is it important to the plant that phloem moves both up and down?
zhuklara [117]
So the entire plant and all of its cells receive water
8 0
3 years ago
Which of the following situations would most likely lead to a stable population size?
marin [14]

Answer:A

Explanation:

3 0
2 years ago
Read 2 more answers
Which of the following is NOT a natural resource?
Shalnov [3]

Answer:

D

Explanation:

Fire is man made because for there to be fire you have to strike a match or use other man made sources

4 0
3 years ago
What kind of plate boundary results in a fault?
Bumek [7]
a transform boundary because the two plates pass each other in that same plane and the blocks of rock move in opposite horizontal directions .
6 0
3 years ago
Read 2 more answers
Other questions:
  • The plasma membrane is responsible for which set of functions listed below?
    15·1 answer
  • _____ is a stepwise series of enzyme-mediated reactions that collectively build, remodel, or break down an organic molecules.
    11·1 answer
  • How have earth scientists improved our understanding of the environment?
    5·1 answer
  • Total these measurements. Your answer should indicate the proper accuracy. Include units.
    7·1 answer
  • Which pair of properties apply to both mechanical and electromagnetic waves?
    12·1 answer
  • In a typical food chain, about what percentage of energy is passed on to the next trophic level? A) 1% B) 10% C) 20% D) 40%
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 4. In science, most concepts are related to other concepts. Which of the following is most closely related to the Law
    9·1 answer
  • plants such as the venus flytrap produce chemical compounds that break down insects into substances that are usable by the plant
    7·1 answer
  • Honey bees often make homes in the hollow knots of trees. The tree is unaffected by this relationship while the
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!