1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Klio2033 [76]
3 years ago
9

What is DNA? (Choose all that apply.)

Biology
1 answer:
Talja [164]3 years ago
8 0

Answer:

im sure its "a molecule unique to each individual"

Explanation:

You might be interested in
In humans, the hormone testosterone enters cells and binds to specific proteins, which in turn bind to specific sites on the cel
LuckyWell [14K]

Answer:

As a transcription factor

Explanation:

Testosterone is a male sex hormone secreted by the testicles which promote the growth of the male reproductive organs and the male characters like muscle buildup.

The hormone shows the paracrine effect and thus act on the target cell at distant. The mechanism of action of the testosterone is that it controls the gene expression of various other genes.

The testosterone binds the specific proteins which activate the expression of the gene that is they acts as a transcription factor which activates the expression.  

Thus, as a transcription factor is correct.

4 0
3 years ago
Identity achievement has been associated with all of the following except _________. A. High self-esteem B. Achievement motivati
Alex777 [14]

Answer:

C. Insecurity

Explanation:

5 0
2 years ago
How is the size of a planet related to the thickness of its atmosphere
Butoxors [25]
<span>Many planets are made of gas, and in different situations, the atmosphere can be destroyed.

The sun which is burnt measures atmosphere and in the same case planets can be in a good situation on galactic map and a great condition in the atmosphere as well as earth.
For example, the mass of an object can attract a smaller object causing gravity. The bigger the masses of a planet when it is in the right condition the more atmosphere it can attract if there is any floating on the planet. If it is big it will make a gravitational influence and gather more gases.</span>
7 0
3 years ago
Read 2 more answers
Which of the following supports the conclusion that if the digestive system is unhealthy, the excretory system will also be unhe
Nina [5.8K]

Answer:

D

Explanation:

Because every system in the body is vital

4 0
3 years ago
Mating is rarely random. Many organisms choose a mate for specific reasons - body size, coloration, antler size, feather length,
poizon [28]

Answer:

Natural selection

Explanation:

Sexual selection refers to the natural selection where the allele frequencies of a population are changed due to nonrandom mating between the individuals. Certain preferences for the mate by organisms result in sexual selection. It is mostly exhibited by females.

For example, peahen prefers the peacocks with elaborate tail features as their mate. The sexual selection also occurs when there is competition among the members of the same sex for a mate. This type of sexual selection is mostly exhibited by males and results in fighting and display.

3 0
3 years ago
Other questions:
  • Name two different methods for evaluating evidence. Compare and contrast these two methods?
    8·1 answer
  • Name the two types of vectors.
    6·2 answers
  • At what phase of mitosis does the amount of genetic material in each chromosome become half of what it just was?
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Rh incompatibility between a sensitized Rh+ woman and an Rh- fetus can cause hemolytic disease of the newborn. True False
    15·1 answer
  • The absence of ______ in the primitive atmosphere was essential to the origin of life on Earth.
    12·1 answer
  • Fructose, the monosaccharide made by plants, is what type of macromolecule
    14·1 answer
  • Our bodies do not make starch, but we often eat plant foods which contain starch which we digest into _____________, the buildin
    10·1 answer
  • This was used to print bank notes by the japanese​
    9·1 answer
  • A person who eats a chicken
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!