1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
15

Multicellular organisms use cell division, mitosis, for growth and the maintenance and repair of cells and tissues. Single-celle

d organisms may use cell division as their method of reproduction. Regardless of the reason for mitosis, the process ensures genetic continuity. What is the step in the cell cycle that ensure genetic continuity?
Biology
1 answer:
slega [8]3 years ago
7 0

Answer:

Anaphase ensures genetic continuity

Explanation:

You might be interested in
&gt;<br><br><br> When did the impact of human societies greatly increase
elena55 [62]

The impact of human societies greatly <em><u>started following the </u></em><em><u>industrial revolution</u></em><em><u> in the 1800s which increased in further at the half of the 20th Century.</u></em>

The human society through industrial revolution that began after the World War II started having a huge negative impact on the environment and the climate. This gave rise to climate change and other challenges faced in our contemporary world.

Production and use of industrial chemicals boomed. Agricultural and pharmaceutical chemicals are implicated in altering the environment as heavy use and their impacted were recorded at the half of the 20th century.

Pollutants from industries and farms become more pronounced at the period even up till now.

Therefore, the impact of human societies can be said to have greatly increased <em><u>in the </u></em><em><u>post-World War II period</u></em><em><u> in the 1800s as a result of the </u></em><em><u>industrial revolution</u></em><em><u> up to the half of the 20th century.</u></em>

Learn more about human societies here:

brainly.com/question/16416711

5 0
3 years ago
Which of the following is considered a major component of cells and has a role in developing and repairing bone, muscle, skin an
suter [353]
The answer is c. protein
7 0
3 years ago
What event happens underwater to cause a tsunami?
Zigmanuir [339]
"Earthquake" <span>happens underwater to cause a tsunami

Hope this helps!</span>
4 0
3 years ago
Read 2 more answers
Small molecules are combined to form large molecules by the life function of
Mnenie [13.5K]
By life function of SYNTHESIS.............
8 0
3 years ago
Read 2 more answers
Which of the following explains how cells become specialized to develop into parts of organ systems?
Kitty [74]

Answer:

C.Cells develop in particular areas of the body, which gives them the same functions

Explanation:

Cell differentiation is the process of cells becoming specialized as their body develops. ... Through the action of these transcription factors, cells specialize into one of hundreds of different cell types in the human body.Cell differentiation is how generic embryonic cells become specialized cells. This occurs through a process called gene expression. Gene expression is the specific combination of genes that are turned on or off (expressed or repressed), and this is what dictates how a cell functions

4 0
3 years ago
Other questions:
  • When rice is left in a pan of water overnight, what will happen to the rice? This process is called?
    11·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Need help with understanding the difference between homologous chromosome, chromatid and how a important are they in meiosis and
    13·1 answer
  • The invention of which instrument allowed scientists to discover cells?
    8·1 answer
  • Which of the following sensory receptors is correctly paired with its category?
    14·1 answer
  • For both groups of plants, what BEST describes the relationship between light intensity and rate of photosynthesis?
    8·1 answer
  • 3 different solutions to solve we protect the arctic habitat of polar bears from change? explained​
    13·1 answer
  • Part D
    12·1 answer
  • I’m really tiny And stick like glue On the sides of the ER To make proteins for you. What am I?
    12·1 answer
  • Which is an advantage of a natural-gas-burning power plant over an oil-
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!