1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krok68 [10]
3 years ago
5

Why do you think that the evolutionary history of life is different from the accounts found in religious books ?

Biology
1 answer:
Oksanka [162]3 years ago
4 0
Because religious people believe in God they don’t believe that they were a fish or an ancient specie in another generation they believe God created the world however people of science believe this is true because it’s nature
You might be interested in
A payment made to someone who has facilitated an activity or appointment, especially illicitly is called a _________.
nasty-shy [4]
I believe the payments/bribes are called kickbacks.  
7 0
4 years ago
What are lipids made of?
Masteriza [31]

Answer:

"Lipids are an essential component of the cell membrane. The structure is typically made of a glycerol backbone, 2 fatty acid tails (hydrophobic), and a phosphate group (hydrophilic)."

3 0
3 years ago
Read 2 more answers
During his voyage on the HMS Beagle, Darwin observed the
babunello [35]

Answer:

A

Explanation:

7 0
3 years ago
Which of these is an example of a chemical change?
lawyer [7]

The correct options are, frying an egg and burning candle.

Explanation :

Physical change : It is a change in which no new compounds are formed only changes occurs in size or state of substance. In this, there is no changes in the substance or compound.

Chemical change : It is a change in which a new compounds are formed by the chemical reaction. Changes occurs in their chemical composition and properties.

Frying an egg : It is a chemical change because a new substance is form by heating.

Burning a candle : It is chemical change because new substances are formed (carbon dioxide, water and heat) by burning.

Boiling alcohol : It is physical change because only changes in the state.

Melting and ice : It is a physical change because only changes in the state.

Making coffee : It is a physical change because no new substance is formed.

Therefore, frying an egg and burning candle are the example of chemical change.

4 0
3 years ago
Read 2 more answers
What is the difference between a heterogeneous mixture and a homogeneous mixture? A. A heterogeneous mixture can only be a solid
I am Lyosha [343]

Answer:

C. You can see the parts in a heterogeneous mixture but can't see them in a homogeneous mixture.

Explanation:

a heterogeneous mixture is in other words, the one that does not mix or is not uniformly combined, hence leading to the creation of layers of the substances used.

a homogeneous mixture is the one that completely dissolves, or mixes, or is uniformly combined.

5 0
3 years ago
Other questions:
  • Energy in organisms is called
    7·1 answer
  • Which of these biomes tends to receive the most rainfall
    7·2 answers
  • What precautions can a scientist take to be protected against charges of fraud?
    11·1 answer
  • What is the meaning of male-female reproduction in relation to chromosomes numbers?
    14·1 answer
  • People with multiple sclerosis (MS) experience many challenging symptoms. Which statement best explains one cause of these diffi
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Researchers do an experiment to test the hypothesis that Douglas fir trees put more resources into reproduction when they are in
    14·1 answer
  • Which statement BEST describes how cancers are classified? A. Cancers are classified according to the type of tissue they affect
    14·1 answer
  • Please help!<br> Need answer fast!
    14·2 answers
  • A blood sample consists of dead cells that are breaking apart into their basic molecular building blocks. What type of molecule
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!