1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wittaler [7]
3 years ago
9

Which is not a basic function of a cell?

Biology
1 answer:
GrogVix [38]3 years ago
3 0

Answer:

D is the answer

Explanation:

You might be interested in
How did Mendel discover that the blending theory of<br> inheritance was incorrect using pea plants?
mariarad [96]

Answer:

Mendel disproved the blending theory of genetics when he cross pollinated tall and short pea plants and the offspring were either tall or short, not medium like the blending theory of genetics suggests.

Explanation:

4 0
3 years ago
Which animal could a polar bear mate with to produce offspring?
Monica [59]

they can mate with grizzlies

6 0
4 years ago
Read 2 more answers
HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP<br> they asked for 20 characters so I’m trying here
KengaRu [80]

Answer:

a meteor I hope it awnserd your question

7 0
3 years ago
Describe what is happening at each phase of meiosis​
Alex

The process of meiosis takes place in two phases. Meiosis I; Meiosis II; Phases of Meiosis 1 and Meiosis 2. During meiosis I, a cell is divided into two, and in meiosis II, further division takes place, resulting in a total of four haploid cells. Before the start of the process, the parent cell goes through a stage of preparation called the interphase.

answer was found here -https://ibiologia.com/phases-of-meiosis/#:~:text=The%20process%20of%20meiosis%20takes%20place%20in%20two,through%20a%20stage%20of%20preparation%20called%20the%20interphase.

Hope this helps you :3

4 0
3 years ago
Which level of organization is not found in every protein
tigry1 [53]

Answer:

I Think...

Explanation:

Each protein has a particular structure necessary to bind with a high degree of ... Others, like titin (a protein found in muscle), are very large Organization of Protein Structure ... This single hydroxyl orientation difference does not allow galactose to bind to hexokinase and thus hexokinase exhibits specificity of binding.

8 0
3 years ago
Other questions:
  • Simple diffusion: requires energy utilizes proteins to move molecules across a membrane moves molecules against a concentration
    8·1 answer
  • The part of the cell that contains the living substance of the cell
    7·1 answer
  • If you want to form a hypothesis, what would you do
    8·2 answers
  • Forensic anthropologists note that if we separate all of humanity into three groups (white, black, Asian), there are common trai
    9·1 answer
  • How do bacteria regulate transcription of these operons?
    5·1 answer
  • U
    15·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • For each of the following, read the characteristics and then identify the kingdom. is mostly unicellular, eukaryotic, and is com
    5·2 answers
  • Why is genetic variation important
    8·1 answer
  • The noble gases in group 18 were some of the last natural elements to be discovered. Why do you think this is so?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!