1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
3 years ago
14

A group of students wants to study the rate of photosynthesis under various conditions. They use a blender to mechanically disru

pt the thylakoid membranes of chloroplasts from an algae sample The liquid
mixture is added to test-tubes, and 5 drops of DPIP solution is added to each tube. One set of tubes is placed in direct sunlight, another is placed in indirect sunlight, and a third is placed under an infrared heat
lamp. One test-tube contains only water and 5 drops of DPIP (control). The students check the color of the liquid in the tubes every 15 minutes for a period of 1 hour. They record their observations in a table
Table of Observations
Time (min) Direct Sunlight
Indirect Sunlight
0
Dark Blue
Dark Blue
15
Lighter
Slightly Lighter
30
Lighter
Lighter
45
Nearly colorless
Lighter
60
Clear colorless
Nearly colorless
Which of the statements is the BEST explanation for their results?
Infrared Lamp
Dark Blue
No Change
Slightly Lighter
Slightly Lighter
Slightly Lighter
Control
Dark Blue
Dark Blue
Dark Blue
Dark Blue
Dark Blue
А
The rate of photosynthesis under indirect sunlight is slower than in infrared light
B
The rate of photosynthesis is greatest for direct sunlight and least for the infrared light.
С
The rate of photosynthesis cannot be determined because the infrared lamp degraded the DPIP
D
The rate of photosynthesis cannot be determined because exposure to direct sunlight degraded the DPIP

Biology
1 answer:
11Alexandr11 [23.1K]3 years ago
4 0

Answer:

B

Explanation:

The statement that best explains the result would be that <u>the rate of photosynthesis is greatest for direct sunlight and least for the infrared light.</u>

The DPIP will normally replace and play the role of NADPH in the light reaction of the process of photosynthesis. Hence, it will become colorless as a result of reduction and the rate of photosynthesis can be monitored based on the magnitude of the disappearance of the dark blue color.

It means that the more colorless the liquid in the illustration is, the more the rate of photosynthesis. <em>The color change moved from dark blue to clear colorless under direct sunlight, from dark blue to nearly colorless under indirect sunlight, and from dark blue to slightly lighter under the infrared light.</em> <u>This clearly indicates that the rate of photosynthesis is highest under direct sunlight and lowest under infrared light with the indirect sunlight having an intermediate rate. </u>

The correct option is B.

You might be interested in
Della recently quit her 20-year smoking habit. how long will it take for her risk of cardiovascular disease to become the same a
givi [52]

It will take 15 years for Della to be in the same risk of non-smoking persons in risk of cardiovascular disease. As you quit smoking, the lungs will start to purify itself, but it will take some time. On the other hand, it cannot be assured that the lungs may be totally restored, more or less it would just be clean over a period of time.

6 0
3 years ago
2. A heart attack occurs when an artery in the heart is blocked, restricting the flow of blood. Why would a heart attack be acco
lorasvet [3.4K]
Your heart pumps blood so it can circulate to your tissues as well as get oxygen from your lungs, if your heart can’t pump blood well i.e. heart attack you can feel short of breath
8 0
3 years ago
PLEASE HELP THIS I NEED TO BOOST MY GRADE<br> What are 3 Florida land forms
Oxana [17]
The South Atlantic Coastal Plain. It extends from Florida's northern border on the Atlantic seaboard, southward about 150 miles to the area around Cape Canaveral, where America's space program first took flight.

The Atlantic Coastal Plain. Atlantic Coastal Plain extends from the south shore of Long Island, New York, all the way to the southern tip of Florida in the Dry Tortugas, five islands west of the Florida Keys. It is only accessible by boat or seaplane.

Florida’s Uplands. Found in the northern panhandle and central part of the state, they are hilly, part of the state's central highlands.
6 0
4 years ago
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
Which procedure is involved in the development of the fetus?
Ilya [14]

Answer:

formation of organ systems

Explanation:

Actually, answer might be formation of organ systems b/c fetus are unborn offspring that have organ systems in place. Thus to develop a fetus the zygote has to multiply and eventually form organ systems (around 8 weeks from conception).

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement describes a way in which the digestive and excretory
    5·1 answer
  • Ice wedging is a form of chemical weathering. t/f
    14·2 answers
  • A new mother of a newborn girl calls the clinic in a panic, concerned about the blood-tinged soiled diaper. what is the best res
    15·1 answer
  • Where does digestion start
    7·2 answers
  • What is it called when vesicles are used to move substances into a cell
    8·2 answers
  • Describe the two main types of chemical bonds that are found in compounds.
    15·1 answer
  • Someone me Help please ASAP
    12·1 answer
  • In a balanced ecosystem, the number of 1. (herbivores, producers, tertiary consumers) is far greater than the number of 2. ( con
    5·2 answers
  • PLZ HELP ME
    9·1 answer
  • The function of meristematic
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!