It will take 15 years for Della to be in the same risk of
non-smoking persons in risk of cardiovascular disease. As you quit smoking, the
lungs will start to purify itself, but it will take some time. On the other
hand, it cannot be assured that the lungs may be totally restored, more or less
it would just be clean over a period of time.
Your heart pumps blood so it can circulate to your tissues as well as get oxygen from your lungs, if your heart can’t pump blood well i.e. heart attack you can feel short of breath
The South Atlantic Coastal Plain. It extends from Florida's northern border on the Atlantic seaboard, southward about 150 miles to the area around Cape Canaveral, where America's space program first took flight.
The Atlantic Coastal Plain. Atlantic Coastal Plain extends from the south shore of Long Island, New York, all the way to the southern tip of Florida in the Dry Tortugas, five islands west of the Florida Keys. It is only accessible by boat or seaplane.
Florida’s Uplands. Found in the northern panhandle and central part of the state, they are hilly, part of the state's central highlands.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Answer:
formation of organ systems
Explanation:
Actually, answer might be formation of organ systems b/c fetus are unborn offspring that have organ systems in place. Thus to develop a fetus the zygote has to multiply and eventually form organ systems (around 8 weeks from conception).