1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ikadub [295]
4 years ago
8

8 Scientists estimate that 200 non-native organisms have been introduced into Chesapeake Bay. Which of these statements is not t

rue about non-native organisms? *
1 point
A They often form mutualistic relationships with native organisms.
B They can deplete the food sources of native organisms.
C They are often aggressive at acquiring and maintaining territory.
D They can prey on native organisms causing them to go extinct.
Biology
1 answer:
Anna007 [38]4 years ago
8 0
B.<span>They can deplete the food sources of native organisms.</span>
You might be interested in
The enlightenment thinker that believed that people had a right to liberty was a man known as Voltaire. TRUE or False
stellarik [79]

Answer:

false

Explanation:

Voltaire was for rights of religion

6 0
3 years ago
Read 2 more answers
A student walking at the beach notices that as he walks away from the water, his feet get hotter. Which explanation agrees with
hammer [34]

Answer:

C,

Explanation:

The sand is just small rocks and pebbles broken down, we know that on a hot day rocks can heat up if left alone for long enough especially if they are dry.

4 0
3 years ago
How does electrocution cause rigid paralysis?
jeyben [28]

Answer:

Muscles are stimulated by electricity. The effect depends on the intensity of the current and the type of muscle it travels through.

The victim may be unable to let go of the source of the current, making the duration of the contact longer and increasing the severity of the shock.

When a current above 10 mA travels through extensor muscles, it causes a violent spasm. If the muscles affected are the hip extensors that lengthen the limbs away from the body, the victim may be propelled, sometimes many metres away!

Muscles, ligaments and tendons may tear as a result of the sudden contraction caused by an electric shock. Tissue can also be burned if the shock is lasting or the current is high.planation:

7 0
4 years ago
The number of major histocompatibility (MHC) protein combinations possible in a given population is enormous. However, an indivi
attashe74 [19]

Answer:

The correct answer is "each of the MHC genes has a large number of alleles, but each individual only inherits two for each gene".

Explanation:

In normal conditions, an individual has only two different alleles for a given gene: one inherited from his mother and the other from his father. However, this does not mean that among humans, there are only two different alleles for each gene. The major histocompatibility (MHC) genes are a clear example of this, since there are multiple combinations for each MHC class. For instance, there are 40 very similar alleles only for the HLA-B27 subtype.

6 0
3 years ago
To maintain homeostasis what must follow the chemical decomposition of food for energy production?
Nastasia [14]
<span>A. removal of wastes</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • How are solar energy, the weather, and the water cycle related?
    13·2 answers
  • Air contains 78 percent, nitrogen 21 percent oxygen, and one percent argon. Which gas is the solvent?
    6·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What process changed the genetics of some rabbits over many generations to give them white or spotted fur and to make them frien
    5·1 answer
  • Which of the following is not part of the cell theory? (4 points) Every living thing is composed of cells. Cells come from pre-e
    9·2 answers
  • Endangered species are ?
    5·1 answer
  • PLS HELP ASAP
    14·2 answers
  • Please help!
    8·1 answer
  • Overgrazing in the sahel is limiting sustainable development in africa because —.
    9·1 answer
  • Write 50 reasons why dogs are better than cats (Easy)
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!